SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


bacillithiol-S-transferase; confers resistence against antimicrobial compounds from B. amyloliquefaciens
17.03 kDa
protein length
144 aa Sequence Blast
gene length
435 bp Sequence Blast
confers resistence against antimicrobial compounds from B. amyloliquefaciens
fosfomycin resistance protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    1,916,663 1,917,097

    Phenotypes of a mutant

  • sensitive to fosfomycin [pubmed|11244082]
  • The protein

    Protein family

  • fosfomycin resistance protein family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|VOC domain] (aa 5-120) (according to UniProt)
  • [SW|Cofactors]

  • Mg2+ [pubmed|11244082]
  • Structure

  • [PDB|4JD1] (from B. anthracis, 66% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11244082], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • expressed under stress conditions ([protein|search|SigW]) [Pubmed|11244082]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|fosB]' and '[protein|search|lexA]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • MGNA-B387 (yndN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE17840 ([gene|92E4F908B7CDE64743796CCD3188FE6BB5288365|fosB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAATCATTCCCCCCTTG, downstream forward: _UP4_TGATAGCACAACCATATTTC
  • BKK17840 ([gene|92E4F908B7CDE64743796CCD3188FE6BB5288365|fosB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAATCATTCCCCCCTTG, downstream forward: _UP4_TGATAGCACAACCATATTTC
  • References

  • 11244082,16629676,20525796,23030527,23256780