SubtiBank SubtiBank
fosB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

fosB

bacillithiol-S-transferase; confers resistence against antimicrobial compounds from B. amyloliquefaciens
locus
BSU17840
pI
6.14
mw
17.03 kDa
protein length
144 aa Sequence Blast
gene length
435 bp Sequence Blast
function
confers resistence against antimicrobial compounds from B. amyloliquefaciens
product
fosfomycin resistance protein
essential
no
synonyms
yndN

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    1,916,663 1,917,097

    Phenotypes of a mutant

  • sensitive to fosfomycin [pubmed|11244082]
  • The protein

    Protein family

  • FosB subfamily (according to Swiss-Prot)
  • [SW|Cofactors]

  • Mg2+ [pubmed|11244082]
  • Structure

  • [PDB|4JD1] (from B. anthracis, 66% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|92E4F908B7CDE64743796CCD3188FE6BB5288365|fosB]
    description
    [Pubmed|11244082]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11244082], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • expressed under stress conditions ([protein|search|SigW]) [Pubmed|11244082]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|fosB]' and '[protein|search|lexA]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B387 (yndN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1386 NBRP B. subtilis, Japan]
  • BKE17840 ([gene|92E4F908B7CDE64743796CCD3188FE6BB5288365|fosB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAATCATTCCCCCCTTG, downstream forward: _UP4_TGATAGCACAACCATATTTC
  • BKK17840 ([gene|92E4F908B7CDE64743796CCD3188FE6BB5288365|fosB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAATCATTCCCCCCTTG, downstream forward: _UP4_TGATAGCACAACCATATTTC
  • References

  • 11244082,16629676,20525796,23030527,23256780