SubtiBank SubtiBank
fosB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

fosB

bacillithiol-S-transferase; confers resistence against antimicrobial compounds from B. amyloliquefaciens
locus
BSU_17840
pI
6.14
mw
17.03 kDa
protein length
144 aa Sequence Blast
gene length
435 bp Sequence Blast
function
confers resistence against antimicrobial compounds from B. amyloliquefaciens
product
fosfomycin resistance protein
essential
no
synonyms
yndN

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    1,916,663 1,917,097

    Phenotypes of a mutant

  • sensitive to fosfomycin [pubmed|11244082]
  • The protein

    Protein family

  • fosfomycin resistance protein family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|VOC domain] (aa 5-120) (according to UniProt)
  • [SW|Cofactors]

  • Mg2+ [pubmed|11244082]
  • Structure

  • [PDB|4JD1] (from B. anthracis, 66% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|92E4F908B7CDE64743796CCD3188FE6BB5288365|fosB]
    description
    [Pubmed|11244082]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11244082], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • expressed under stress conditions ([protein|search|SigW]) [Pubmed|11244082]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|fosB]' and '[protein|search|lexA]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B387 (yndN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1386 NBRP B. subtilis, Japan]
  • BKE17840 ([gene|92E4F908B7CDE64743796CCD3188FE6BB5288365|fosB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAATCATTCCCCCCTTG, downstream forward: _UP4_TGATAGCACAACCATATTTC
  • BKK17840 ([gene|92E4F908B7CDE64743796CCD3188FE6BB5288365|fosB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAATCATTCCCCCCTTG, downstream forward: _UP4_TGATAGCACAACCATATTTC
  • References

  • 11244082,16629676,20525796,23030527,23256780