SubtiBank SubtiBank
ktrA [2019-02-14 12:11:34]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ktrA [2019-02-14 12:11:34]

high affinity potassium channel [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|KtrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|KtrB], peripheric membrane component
24.73 kDa
protein length
222 aa Sequence Blast
gene length
669 bp Sequence Blast
potassium uptake
high affinity potassium channel [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|KtrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|KtrB], peripheric membrane component

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW|Potassium uptake/ export]
  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.1|Targets of c-di-AMP]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,188,414 3,189,082

    Phenotypes of a mutant

  • a [gene|search|kimA ][gene|search|ktrA ][gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] mutant requires high potassium concentrations on minimal medium with ammonium as nitrogen source [pubmed|28420751,28679749]
  • a [gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] mutant of ''B. subtilis'' NCIB3610 is reduced in sliding (dendritic spreading) [Pubmed|16321950]
  • The protein

    Paralogous protein(s)

  • [protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|KtrC]
  • Kinetic information

  • the [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|KtrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|KtrB] channel has a high affinity for potassium,this is determined by [protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|KtrB] [pubmed|30753894]
  • [SW|Domains]

  • contains a [SW|RCK_N domain] at the N-terminus (according to [ UniProt])
  • contains a [SW|RCK_C domain] at the C-terminus (according to [ UniProt])
  • Effectors of protein activity

  • binds ADP and ATP [pubmed|26771197]
  • Structure

  • [PDB|4J7C] (the [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|KtrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|KtrB] complex) [Pubmed|23598340]
  • [PDB|4XTT] (the ''S. aureus'' KtrA [SW|RCK_C domain] in complex with c-di-AMP, 48% identity) [Pubmed|25957408]
  • [PDB|1LSU] (complex with NADH)
  • [ 2HMW] ( complex with ATP)
  • [SW|Localization]

  • peripheral membrane protein [Pubmed|12562800]
  • Expression and Regulation



    regulatory mechanism

  • [regulon|ydaO riboswitch|ydaO riboswitch]: termination/antitermination, expression is switched off upon binding of c-di-AMP, in [regulon|ydaO riboswitch|ydaO riboswitch]
  • view in new tab

    additional information

  • growth at extreme potassium limitation results in the acquisition of promoter mutations with increased [gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] expression [pubmed|28679749]
  • Biological materials


  • MGNA-B543 (yuaA::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A954 ( ''ktrA''::''kan''), [Pubmed|12562800], available at [ BGSC]
  • GHB1 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''aphA3''), available in [SW|Erhard Bremer]'s lab
  • GP92 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''aphA3''), available in [SW|Jrg Stlke]'s lab [pubmed|28420751]
  • GP2083 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''aphA3'' [gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::''tet''), available in [SW|Jrg Stlke]'s lab [pubmed|28420751]
  • GP2498 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''spc'' [gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]::''cat''), available in [SW|Jrg Stlke]'s lab
  • BKE31090 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTTCATATCTCCCTTA, downstream forward: _UP4_GAAAACGAAGGGATGTAGAC
  • BKK31090 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTTCATATCTCCCTTA, downstream forward: _UP4_GAAAACGAAGGGATGTAGAC
  • GP2716 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''spc''), available in [SW|Jrg Stlke]'s lab
  • Expression vectors

  • pGP2594: (IPTG inducible expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]), available in [SW|Jrg Stlke]'s lab
  • lacZ fusion

  • GP2176 (based on [SW|pAC5]), available in [SW|Jrg Stlke]'s lab
  • GP2177 (based on [SW|pAC7]), available in [SW|Jrg Stlke]'s lab
  • GP2299 (based on [SW|pAC6]), available in [SW|Jrg Stlke]'s lab [pubmed|28679749]
  • References


  • 25869574,27935846,28086088,28825218,25838295
  • Original publications

  • 12562800,15096624,16321950,20511502,23086297,23598340,24141192,25957408,16990138,26771197,28086091,28420751,28504641,28679749,30753894
  • Labs working on this gene/protein

  • [SW|Erhard Bremer], University of Marburg, Germany [ homepage]