SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


general stress protein, survival of ethanol stress
11.25 kDa
protein length
101 aa Sequence Blast
gene length
306 bp Sequence Blast
survival of ethanol stress

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    2,019,421 2,019,726

    The protein

    Protein family

  • short-chain dehydrogenases/reductases (SDR) family (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10482513,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|10482513,15805528]
  • view in new tab

    Biological materials


  • MGNA-A830 (yoxC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE18510 ([gene|928CD0278328BB8642F7D560E42C13D74B4F1341|yoxC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTTCACTCCTTTTCT, downstream forward: _UP4_TAAGGATGAATGAGATCCCG
  • BKK18510 ([gene|928CD0278328BB8642F7D560E42C13D74B4F1341|yoxC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTTCACTCCTTTTCT, downstream forward: _UP4_TAAGGATGAATGAGATCCCG
  • References

  • 15805528,10482513