SubtiBank SubtiBank
yoxC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yoxC

general stress protein, survival of ethanol stress
locus
BSU_18510
pI
10.02
mw
11.25 kDa
protein length
101 aa Sequence Blast
gene length
306 bp Sequence Blast
function
survival of ethanol stress
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    2,019,421 2,019,726

    The protein

    Protein family

  • short-chain dehydrogenases/reductases (SDR) family (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|928CD0278328BB8642F7D560E42C13D74B4F1341|yoxC]-[gene|8C5ECDA04FA75F6FFA8625431AAC6855D8A1DB08|yoxB]-[gene|4A8360E50ADBA4CC859A64A72EBC0A07F70A1764|yoaA]
    description
    [Pubmed|10482513]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10482513,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|10482513,15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A830 (yoxC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/830 NBRP B. subtilis, Japan]
  • BKE18510 ([gene|928CD0278328BB8642F7D560E42C13D74B4F1341|yoxC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTTCACTCCTTTTCT, downstream forward: _UP4_TAAGGATGAATGAGATCCCG
  • BKK18510 ([gene|928CD0278328BB8642F7D560E42C13D74B4F1341|yoxC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTTCACTCCTTTTCT, downstream forward: _UP4_TAAGGATGAATGAGATCCCG
  • References

  • 15805528,10482513