SubtiBank SubtiBank
rsbP [2018-11-07 17:33:15]

rsbP [2018-11-07 17:33:15]

protein serine phosphatase, energy PP2C, dephosphorylates RsbV
locus
BSU34110
pI
4.83
mw
45.87 kDa
protein length
403 aa Sequence Blast
gene length
1209 bp Sequence Blast
function
control of SigB activity
product
protein serine phosphatase, energy PP2C
essential
no
ec
3.1.3.3
synonyms
yvfP

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • Gene

    Coordinates
    3,500,386 → 3,501,597

    The protein

    Catalyzed reaction/ biological activity

  • dephosphorylation of [protein|AC64DA463250A090A62E50901EFE653C8F963872|RsbV] in response to red light, this results in [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activation [Pubmed|19948797]
  • [SW|Domains]

  • N-terminal [SW|PAS domain], central coiled-coil domain, C-terminal PP2C phosphatase domain
  • Effectors of protein activity

  • activity is stimulated upon interaction of the RsbP oligomer with RsbQ [Pubmed|21980452]
  • Expression and Regulation

    Operons

    genes
    [gene|9284E58A2D5394A31658E70879874A1338CF531B|rsbP]-[gene|53496D7AC05B20C5AEB6CB9B9B8825FC987B12C5|rsbQ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A488 (yvfP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/488 NBRP B. subtilis, Japan]
  • BKE34110 (Δ[gene|9284E58A2D5394A31658E70879874A1338CF531B|rsbP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAAGAGGGTCACCTCT, downstream forward: _UP4_TAAAATGATCCATGAGACAT
  • BKK34110 (Δ[gene|9284E58A2D5394A31658E70879874A1338CF531B|rsbP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAAGAGGGTCACCTCT, downstream forward: _UP4_TAAAATGATCCATGAGACAT
  • labs

  • [SW|Chet Price], Davis, USA [http://foodscience.ucdavis.edu/price_lab/pricelab.html homepage]
  • References

    Reviews

  • 20658979
  • Original publications

  • 27977677,19948797,21980452,10632888,15632289