SubtiBank SubtiBank
rsbP [2019-03-12 18:44:08]

rsbP [2019-03-12 18:44:08]

protein serine phosphatase, energy PP2C, dephosphorylates [protein|AC64DA463250A090A62E50901EFE653C8F963872|RsbV]
45.87 kDa
protein length
403 aa Sequence Blast
gene length
1212 bp Sequence Blast
control of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activity
protein serine phosphatase, energy PP2C

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • Gene

    3,500,386 3,501,597

    The protein

    Catalyzed reaction/ biological activity

  • dephosphorylation of [protein|AC64DA463250A090A62E50901EFE653C8F963872|RsbV] in response to red light, this results in [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activation [Pubmed|19948797]
  • [SW|Domains]

  • N-terminal [SW|PAS domain], central coiled-coil domain, C-terminal PP2C phosphatase domain
  • Effectors of protein activity

  • activity is stimulated upon interaction of the RsbP oligomer with RsbQ [Pubmed|21980452]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A488 (yvfP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34110 ([gene|9284E58A2D5394A31658E70879874A1338CF531B|rsbP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAAGAGGGTCACCTCT, downstream forward: _UP4_TAAAATGATCCATGAGACAT
  • BKK34110 ([gene|9284E58A2D5394A31658E70879874A1338CF531B|rsbP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAAGAGGGTCACCTCT, downstream forward: _UP4_TAAAATGATCCATGAGACAT
  • Labs working on this gene/protein

  • [SW|Chet Price], Davis, USA [ homepage]
  • References


  • 20658979
  • Original publications

  • 27977677,19948797,21980452,10632888,15632289,30396900