SubtiBank SubtiBank
yloH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yloH

omega subunit of [SW|RNA polymerase]
locus
BSU_15690
pI
5.51
mw
7.62 kDa
protein length
gene length
204 bp Sequence Blast
function
unknown
product
omega subunit of [SW|RNA polymerase]
essential
no
ec
2.7.7.6
synonyms
rpoZ

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.1|RNA polymerase]
  • Gene

    Coordinates
    1,642,567 1,642,770

    The protein

    Catalyzed reaction/ biological activity

  • ribonucleoside 5'-triphosphate + RNA(n) --> diphosphate + RNA(n+1) (according to UniProt)
  • Protein family

  • [SW|RNA polymerase] subunit omega family (single member, according to UniProt)
  • Structure

  • [PDB|5UH5] (transcription initiation complex from Mycobacterium tuberculosis, 37% identity, aa 1- 52) [pubmed|28392175]
  • [SW|Localization]

  • closely associated with [SW|RNA polymerase] involved in transcribing both mRNA and rRNA operons [Pubmed|20724389]
  • Expression and Regulation

    Operons

    genes
    [gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]-[gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]-[gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]-[gene|921933B6B893083F151AABDEDCBC65F2E55677BE|yloH]

    description

  • [pubmed|22383849]
  • sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|23396918], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed during vegetative growth and early during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|23396918]
  • view in new tab

    genes
    [gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]-[gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]-[gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]-[gene|921933B6B893083F151AABDEDCBC65F2E55677BE|yloH]-[gene|2B67C63442F28F6BCBA3BA6DE4B563C73E8DF16C|yloI]-[gene|AF5ADDA2A98EC18BB72A81AA0336E639C0D1F430|priA]-[gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA]-[gene|06971E9AAB033E2878914A76645F99E97CE8A90A|fmt]-[gene|1370D8783450D538C71E3DE8EA5B37DFEE073FF0|yloM]-[gene|5DEBD84E5937DB8B7F29C729FAA0076DF86A5451|yloN]

    description

  • [pubmed|22383849]
  • view in new tab

    genes
    [gene|7821A09DADC6EAF589A882F05CC34BE900E06F2A|yloB]-[gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]-[gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]-[gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]-[gene|921933B6B893083F151AABDEDCBC65F2E55677BE|yloH]

    description

  • [pubmed|22383849]
  • regulation

  • expressed during sporulation in the mother cell [pubmed|12161109]
  • view in new tab

    Biological materials

    Mutant

  • BKE15690 ([gene|921933B6B893083F151AABDEDCBC65F2E55677BE|yloH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAATTGACGGATCTAACA, downstream forward: _UP4_TAGTAGCACAAGTAGCAACC
  • BKK15690 ([gene|921933B6B893083F151AABDEDCBC65F2E55677BE|yloH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAATTGACGGATCTAACA, downstream forward: _UP4_TAGTAGCACAAGTAGCAACC
  • References

    Reviews

  • 22210308,25878038,32920946
  • Original publications

  • 11158566,20724389,26098117,28392175,27799328