SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcriptional activator ([SW|Xre family]) of competence development and [SW|sporulation] genes, represses [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]-dependent flagellar genes, antagonist of [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] and [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR], has LexA-like autocleavage activity
17.43 kDa
protein length
152 aa Sequence Blast
gene length
459 bp Sequence Blast
regulation of initiation of [SW|biofilm formation] and of autolysis
transcriptional regulator ([SW|Xre family]), [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] antagonist

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.6|Transition state regulators]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Regulation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.4|Swarming]
  • Gene

    3,530,101 3,530,559

    Phenotypes of a mutant

  • smooth colonies on MsGG medium, no [SW|biofilm formation] [Pubmed|22113911]
  • The protein

    Catalyzed reaction/ biological activity

  • [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR] binds to and inhibits the activity of [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA], [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] indirectly stimulates the synthesis of [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR] by interacting with [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]. [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR] can bind to [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] and [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] directly represses the transcription of [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR]. [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR] indirectly derepresses its own gene. The heterocomplex of [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR]-[protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] is a repressor of autolysin and motility genes and inhibits the repressor function of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]. [Pubmed|19788541,20923420,20351052]
  • repression of transcription of ''[gene|497C9654DC7514FF738D18E1F083299C43003A4C|lytA]-[gene|E1F9922DF7273040F84E5AC207A9F4CAFB85DC75|lytB]-[gene|6A21293823151C6980BF52B31A4B249A8440F2E1|lytC]'' and ''[gene|E8B88CBE4F9121DFEEF099D7947CD1E1AE656160|lytF]'' [Pubmed|20351052]
  • autocleavage [Pubmed|20923420]
  • Protein family

  • [SW|Xre family]
  • Paralogous protein(s)

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]
  • [SW|Domains]

  • [SW|HTH cro/C1-type domain] (aa 6-61) (according to UniProt)
  • [SW|Sin domain] (aa 113-151) (according to UniProt)
  • Modification

  • subject to self-cleavage via a LexA-like autopeptidase, this involves [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] and requires [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] [Pubmed|26819068,20923420]
  • Effectors of protein activity

  • interaction with [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] triggers binding of SlrR to the promoters of ''[gene|497C9654DC7514FF738D18E1F083299C43003A4C|lytA]-[gene|E1F9922DF7273040F84E5AC207A9F4CAFB85DC75|lytB]-[gene|6A21293823151C6980BF52B31A4B249A8440F2E1|lytC]'' and ''[gene|E8B88CBE4F9121DFEEF099D7947CD1E1AE656160|lytF]'', resulting in their repression [Pubmed|20351052]
  • Expression and Regulation



    regulatory mechanism

  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: activation, [Pubmed|19767430], in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|19788541], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • additional information

  • induction by sequestration of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] by [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI], [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] [PubMed|15661000,19788541] or by SlrR itself [PubMed|20351052]
  • view in new tab

    Biological materials


  • MGNA-A089 (slr::erm), available at the [ NBRP B. subtilis, Japan]
  • GP955 (''slrR''-''[gene|7FCB9037FDDC176FCF76088ADE7387A6A37068A9|pnbA]''::''cat''), available in [SW|Jörg Stülke]'s lab
  • BKE34380 ([gene|920F91E748EE079FF864011D9052B073567C41E4|slrR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATATGAAATTCTCCTC, downstream forward: _UP4_TGATGATCGGTTAAAGGGCT
  • BKK34380 ([gene|920F91E748EE079FF864011D9052B073567C41E4|slrR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATATGAAATTCTCCTC, downstream forward: _UP4_TGATGATCGGTTAAAGGGCT
  • Expression vector

  • pGP2312: expression in ''E. coli'', with C-terminal Strep-tag, in [SW|pGP574], available in [SW|Jörg Stülke]'s lab
  • pGP2905: expression in ''E. coli'', with N-terminal His-tag, in [SW|pWH844], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in [SW|Jörg Stülke]'s lab
  • References


  • 20541494,23353768,24988880
  • Original publications

  • 23378512,23430750,21856853,22329926,22113911,20817675,18430133,18647168,19767430,19788541,20351052,20923420,24256735,26819068,28546427,31604312