SubtiBank SubtiBank
iolU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

iolU

minor NADP-dependent scyllo-inositol dehydrogenase
locus
BSU31170
pI
5.15
mw
36.36 kDa
protein length
328 aa Sequence Blast
gene length
987 bp Sequence Blast
function
utilization of scyllo-inosose
product
minor NADP-dependent scyllo-inositol dehydrogenase
essential
no
synonyms
yulF

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.16|Utilization of inositol]
  • Gene

    Coordinates
    3,196,906 3,197,892

    The protein

    Catalyzed reaction/ biological activity

  • NADPH-dependent conversion of scyllo-inosose to scyllo-inositol [pubmed|28043209]
  • Protein family

  • [SW|Gfo/Idh/MocA family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|IolG], [protein|942BAE9FA023DFCA06B6D26A856A72F2979E23FA|YrbE], [protein|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|IolX], [protein|03BE6DA854612B3F6741E0E167AB310F0DE96285|YfiI], [protein|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|NtdC], [protein|484D17480DFAD3667E0EBC6D38854A7546A8DB46|YteT], [protein|7DFE74C751A67CCC84579D52005E1399B0A10166|IolW]
  • [SW|Cofactors]

  • NADP+ [pubmed|28043209]
  • Structure

  • [PDB|4NHE] (oxidoreductase from ''Streptococcus pneumoniae'')
  • Expression and Regulation

    Operons

    genes
    [gene|920C5750CB95102B073C32874D512E8D636D2C7D|iolU]
    description
    [Pubmed|9274030]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A228 (yulF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/228 NBRP B. subtilis, Japan]
  • BKE31170 ([gene|920C5750CB95102B073C32874D512E8D636D2C7D|iolU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCGTATCGCTCCTTTTG, downstream forward: _UP4_TAAAAAAATCCGCCCGCGTG
  • BKK31170 ([gene|920C5750CB95102B073C32874D512E8D636D2C7D|iolU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCGTATCGCTCCTTTTG, downstream forward: _UP4_TAAAAAAATCCGCCCGCGTG
  • References

  • 9274030,28043209