SubtiBank SubtiBank
ssuC

ssuC

aliphatic sulfonate [SW|ABC transporter] (permease)
locus
BSU_08850
pI
10.48
mw
30.09 kDa
protein length
276 aa Sequence Blast
gene length
831 bp Sequence Blast
function
sulfonate uptake
product
aliphatic sulfonate [SW|ABC transporter] (permease)
essential
no
synonyms
ygaM,yzeB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.6|Uptake of ions]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.2|sulfur metabolism/ general]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    963,174 964,004

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|CysTW subfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|ABC transmembrane type-1 domain](aa 80-260) (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|675CE0BCA393E9C2795032F1C0FDE6AF08B77033|ssuB]-[gene|B47C64731FCAA086CA563EEE95D3205428E51EFC|ssuA]-[gene|91EAC386AD3A373E7CDE0265AA23786ADC55558A|ssuC]-[gene|A9F7BEC330EB17CA38C4D421E8BBF58CE380559C|ssuD]-[gene|93F7A5795A423CD8DD7B070F7F37731A5E8D6321|ygaN]
    description
    [Pubmed|11251850]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11251850], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|search|CymR]) [Pubmed|16513748]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A247 (ygaM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/247 NBRP B. subtilis, Japan]
  • 1A800 ( ''ssuC''::''kan''), [Pubmed|9782504], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A800&Search=1A800 BGSC]
  • BKE08850 ([gene|91EAC386AD3A373E7CDE0265AA23786ADC55558A|ssuC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGAGCCCGCAGCCTCTGCTT, downstream forward: _UP4_TAAAAGATATAAAGGGGAGA
  • BKK08850 ([gene|91EAC386AD3A373E7CDE0265AA23786ADC55558A|ssuC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGAGCCCGCAGCCTCTGCTT, downstream forward: _UP4_TAAAAGATATAAAGGGGAGA
  • References

  • 15937167,9782504,10092453,11251850,16513748