SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


aliphatic sulfonate [SW|ABC transporter] (permease)
30.09 kDa
protein length
276 aa Sequence Blast
gene length
831 bp Sequence Blast
sulfonate uptake
aliphatic sulfonate [SW|ABC transporter] (permease)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of ions]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|sulfur metabolism/ general]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    963,174 964,004

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|CysTW subfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|ABC transmembrane type-1 domain](aa 80-260) (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11251850], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|search|CymR]) [Pubmed|16513748]
  • view in new tab

    Biological materials


  • MGNA-A247 (ygaM::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A800 ( ''ssuC''::''kan''), [Pubmed|9782504], available at [ BGSC]
  • BKE08850 ([gene|91EAC386AD3A373E7CDE0265AA23786ADC55558A|ssuC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGAGCCCGCAGCCTCTGCTT, downstream forward: _UP4_TAAAAGATATAAAGGGGAGA
  • BKK08850 ([gene|91EAC386AD3A373E7CDE0265AA23786ADC55558A|ssuC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGAGCCCGCAGCCTCTGCTT, downstream forward: _UP4_TAAAAGATATAAAGGGGAGA
  • References

  • 15937167,9782504,10092453,11251850,16513748