SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to oligoendopeptidase, inactive pseudogene
57.00 kDa
protein length
502 aa Sequence Blast
gene length
1509 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    3,380,704 3,382,212

    The protein

    Paralogous protein(s)

  • [protein|3F0700B5E3B944116D2F9A150F7AB4263A3E41EE|PepF]
  • Structure

  • [PDB|3CE2] (from Chlamydophila abortus, 23% identity)
  • Expression and Regulation




  • [Pubmed|22383849]
  • view in new tab

    Biological materials


  • BKE32960 ([gene|91C89960ABE800BB25CA48A97A5D32CC308D3D31|yusY/1]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAGGCCTGATGCTCTATAGC, downstream forward: _UP4_TAAAGAAAAAGCCGTGGCGT
  • BKK32960 ([gene|91C89960ABE800BB25CA48A97A5D32CC308D3D31|yusY/1]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAGGCCTGATGCTCTATAGC, downstream forward: _UP4_TAAAGAAAAAGCCGTGGCGT
  • References

  • 11741842