SubtiBank SubtiBank
gpr
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gpr

germination protease (degradation of SASPs)
locus
BSU_25540
pI
5.20
mw
40.12 kDa
protein length
368 aa Sequence Blast
gene length
1107 bp Sequence Blast
function
degradation of SASPs
product
germination protease (degradation of SASPs)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.3|Proteolysis during sporulation/ germination]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • Gene

    Coordinates
    2,634,505 2,635,611

    The protein

    Catalyzed reaction/ biological activity

  • degradation of small, acid-soluble spore proteins (SASPs) [Pubmed|8478323]
  • Endopeptidase action with P4 Glu or Asp, P1 preferably Glu > Asp, P1' hydrophobic and P2' Ala (according to UniProt)
  • Protein family

  • peptidase A25 family (single member, according to UniProt)
  • Structure

  • [PDB|1C8B] (from B. megaterium, 68% identity) [pubmed|10864493]
  • [SW|Localization]

  • inner spore membrane [Pubmed|26731423]
  • Expression and Regulation

    Operons

    genes
    [gene|91C5AF928EB8E00F12D1BC0E788E1CB116F87B04|gpr]-[gene|C9817A54C8E72193280E393D7BD3375BD1751738|spoIIP]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325,1840582], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|1840582], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, [Pubmed|16497325], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF], [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG], [SW|SpoVT]) [Pubmed|16497325,1840582]
  • view in new tab

    Biological materials

    Mutant

  • BKE25540 ([gene|91C5AF928EB8E00F12D1BC0E788E1CB116F87B04|gpr]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGGGGCCTCCTTCAC, downstream forward: _UP4_TAAACAGTTCTACTTCCTCT
  • BKK25540 ([gene|91C5AF928EB8E00F12D1BC0E788E1CB116F87B04|gpr]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGGGGCCTCCTTCAC, downstream forward: _UP4_TAAACAGTTCTACTTCCTCT
  • References

  • 16199582,9045848,8188581,8071242,1732215,16497325,7961468,8071212,9748439,1840582,7608092,8478323,23927687,26731423,10864493