SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


germination protease (degradation of SASPs)
40.12 kDa
protein length
368 aa Sequence Blast
gene length
1107 bp Sequence Blast
degradation of SASPs
germination protease (degradation of SASPs)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Proteolysis during sporulation/ germination]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Additional germination proteins]
  • Gene

    2,634,505 2,635,611

    The protein

    Catalyzed reaction/ biological activity

  • degradation of small, acid-soluble spore proteins (SASPs) [Pubmed|8478323]
  • Endopeptidase action with P4 Glu or Asp, P1 preferably Glu > Asp, P1' hydrophobic and P2' Ala (according to UniProt)
  • Protein family

  • peptidase A25 family (single member, according to UniProt)
  • Structure

  • [PDB|1C8B] (from B. megaterium, 68% identity) [pubmed|10864493]
  • [SW|Localization]

  • inner spore membrane [Pubmed|26731423]
  • Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325,1840582], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|1840582], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, [Pubmed|16497325], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF], [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG], [SW|SpoVT]) [Pubmed|16497325,1840582]
  • view in new tab

    Biological materials


  • BKE25540 ([gene|91C5AF928EB8E00F12D1BC0E788E1CB116F87B04|gpr]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGGGGCCTCCTTCAC, downstream forward: _UP4_TAAACAGTTCTACTTCCTCT
  • BKK25540 ([gene|91C5AF928EB8E00F12D1BC0E788E1CB116F87B04|gpr]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGGGGCCTCCTTCAC, downstream forward: _UP4_TAAACAGTTCTACTTCCTCT
  • References

  • 16199582,9045848,8188581,8071242,1732215,16497325,7961468,8071212,9748439,1840582,7608092,8478323,23927687,26731423,10864493