SubtiBank SubtiBank


germination protease (degradation of SASPs)
40.12 kDa
protein length
368 aa Sequence Blast
gene length
1107 bp Sequence Blast
degradation of SASPs
germination protease (degradation of SASPs)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Proteolysis during sporulation/ germination]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Additional germination proteins]
  • Gene

    2,634,505 2,635,611

    The protein

    Catalyzed reaction/ biological activity

  • degradation of small, acid-soluble spore proteins (SASPs) [Pubmed|8478323]
  • Endopeptidase action with P4 Glu or Asp, P1 preferably Glu > Asp, P1' hydrophobic and P2' Ala (according to UniProt)
  • Protein family

  • peptidase A25 family (single member, according to UniProt)
  • Structure

  • [PDB|1C8B] (from B. megaterium, 68% identity) [pubmed|10864493]
  • [SW|Localization]

  • inner spore membrane [Pubmed|26731423]
  • Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325,1840582], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|1840582], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, [Pubmed|16497325], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF], [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG], [SW|SpoVT]) [Pubmed|16497325,1840582]
  • view in new tab

    Biological materials


  • BKE25540 ([gene|91C5AF928EB8E00F12D1BC0E788E1CB116F87B04|gpr]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGGGGCCTCCTTCAC, downstream forward: _UP4_TAAACAGTTCTACTTCCTCT
  • BKK25540 ([gene|91C5AF928EB8E00F12D1BC0E788E1CB116F87B04|gpr]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGGGGCCTCCTTCAC, downstream forward: _UP4_TAAACAGTTCTACTTCCTCT
  • References

  • 16199582,9045848,8188581,8071242,1732215,16497325,7961468,8071212,9748439,1840582,7608092,8478323,23927687,26731423,10864493