SubtiBank SubtiBank
yqcC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqcC

similar to phage-related protein
locus
BSU_25950
pI
5.82
mw
41.22 kDa
protein length
366 aa Sequence Blast
gene length
1101 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,667,390 2,668,490

    Biological materials

    Mutant

  • BKE25950 ([gene|91AF3037284978F664448DFD1994238CA02D3D16|yqcC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTTTTGCATCATAAGCCA, downstream forward: _UP4_TATCCAAGATTTTAGGAGGT
  • BKK25950 ([gene|91AF3037284978F664448DFD1994238CA02D3D16|yqcC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTTTTGCATCATAAGCCA, downstream forward: _UP4_TATCCAAGATTTTAGGAGGT