SubtiBank SubtiBank
yqcC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqcC

similar to phage-related protein
locus
BSU_25950
pI
5.82
mw
41.22 kDa
protein length
366 aa Sequence Blast
gene length
1101 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,667,390 2,668,490

    Biological materials

    Mutant

  • BKE25950 ([gene|91AF3037284978F664448DFD1994238CA02D3D16|yqcC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTTTTGCATCATAAGCCA, downstream forward: _UP4_TATCCAAGATTTTAGGAGGT
  • BKK25950 ([gene|91AF3037284978F664448DFD1994238CA02D3D16|yqcC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTTTTGCATCATAAGCCA, downstream forward: _UP4_TATCCAAGATTTTAGGAGGT