SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


28.03 kDa
protein length
255 aa Sequence Blast
gene length
768 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,586,813 2,587,580

    The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE25040 ([gene|918E149F605D16502762657A6EF52092CC3794AC|yqgB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATCTTCACTTCCTAGC, downstream forward: _UP4_TAAATTATATTTATTTTTAT
  • BKK25040 ([gene|918E149F605D16502762657A6EF52092CC3794AC|yqgB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATCTTCACTTCCTAGC, downstream forward: _UP4_TAAATTATATTTATTTTTAT