SubtiBank SubtiBank
yqgB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqgB

unknown
locus
BSU_25040
pI
9.69
mw
28.03 kDa
protein length
255 aa Sequence Blast
gene length
768 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,586,813 2,587,580

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|918E149F605D16502762657A6EF52092CC3794AC|yqgB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE25040 ([gene|918E149F605D16502762657A6EF52092CC3794AC|yqgB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATCTTCACTTCCTAGC, downstream forward: _UP4_TAAATTATATTTATTTTTAT
  • BKK25040 ([gene|918E149F605D16502762657A6EF52092CC3794AC|yqgB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATCTTCACTTCCTAGC, downstream forward: _UP4_TAAATTATATTTATTTTTAT