SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


ribose-5-phosphate isomerase
16.07 kDa
protein length
149 aa Sequence Blast
gene length
450 bp Sequence Blast
pentose phosphate pathway
ribose-5-phosphate isomerase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Pentose phosphate pathway]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • Gene

    3,791,199 3,791,648

    Phenotypes of a mutant

  • poor growth [pubmed|28189581]
  • poorly transformable [pubmed|28189581]
  • The protein

    Protein family

  • LacAB/RpiB family (single member, according to UniProt)
  • Kinetic information

  • Reversible Mass Action Kinetics [Pubmed|956158] [Pubmed|7144591]
  • Effectors of protein activity

  • Inhibited by 6-phosphogluconate and AMP [Pubmed|7144591]
  • Inhibited by divalent ions such as Ag2+, Mg2+, Co2+ and Zn2+ [Pubmed|956158]
  • Activated by EDTA and 2-mercaptoethanol [Pubmed|7144591]
  • Structure

  • [PDB|3HEE] (from ''Clostridium thermocellum'', 55% identity, 72% similarity) [pubmed|21253719]
  • Additional information

  • The enzyme has probably more than one active site, but with no cooperativity described [Pubmed|7144591]
  • Expression and Regulation



    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • repressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    view in new tab

    view in new tab

    Biological materials


  • BKE36920 ([gene|91827FEC70F5EEB8B072D06ABA05C19FC54D5F71|ywlF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGCTTTTCCTCCCAGC, downstream forward: _UP4_AAAAACCTGTAGGGGTGCTG
  • BKK36920 ([gene|91827FEC70F5EEB8B072D06ABA05C19FC54D5F71|ywlF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGCTTTTCCTCCCAGC, downstream forward: _UP4_AAAAACCTGTAGGGGTGCTG
  • FLAG-tag construct

  • GP1404 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • **
  • References

  • 25755103,12823818,19446032,956158,7144591,956158,21253719,28189581