SubtiBank SubtiBank
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website


part of the [SW|condensin] complex, chromosomal origin condensation and segregation
21.89 kDa
protein length
197 aa Sequence Blast
gene length
594 bp Sequence Blast
segregation of replication origins
DNA segregation and condensation protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.3|DNA condensation/ segregation]
  • Gene

    2,425,248 2,425,841

    Phenotypes of a mutant

  • essential [Pubmed|24440399], non-essential according to [Pubmed|28189581]
  • ''[gene|9137D162E6331E2B127472BCF5F49A9AE46266F3|scpB]'' mutants are not viable on complex medim that allow rapid growth, but they are viable under conditions of slow growth [Pubmed|24440399,24440393]
  • The protein

    Catalyzed reaction/ biological activity

  • negatively regulates binding of the [protein|8DD968C97FDC0E81293887E2FCB7EE1A9416A333|ScpA] NTD to the [protein|0136394A52759CEEDD8DE074ED74033C6FFB8435|Smc] neck region [pubmed|28286005]
  • Protein family

  • scpB family (single member, according to UniProt)
  • Structure

  • [PDB|4I98] (complex between [protein|8DD968C97FDC0E81293887E2FCB7EE1A9416A333|ScpA] (aa 1-160)-[protein|9137D162E6331E2B127472BCF5F49A9AE46266F3|ScpB] (aa 1-183) [Pubmed|23353789]
  • [SW|Localization]

  • nucleoid (Multiple) [Pubmed|16479537]
  • the [SW|condensin] ([protein|0136394A52759CEEDD8DE074ED74033C6FFB8435|Smc])2-[protein|8DD968C97FDC0E81293887E2FCB7EE1A9416A333|ScpA]-[protein|9137D162E6331E2B127472BCF5F49A9AE46266F3|ScpB] complex is loaded by [protein|EF4BD49FCD49EE97908973581478951C8FA196C0|ParB] to ''parS'' centromeric sites adjacent to the replication origin, travels then from the origin to the terminus at rates >50 kb per minute [Pubmed|28154080,24440393,23475963]
  • Expression and Regulation



    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|search|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    Biological materials


  • MGNA-A105 (ypuH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE23210 ([gene|9137D162E6331E2B127472BCF5F49A9AE46266F3|scpB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATAGCTTTCCAATTCA, downstream forward: _UP4_TAGAAGTTTAATGAATCGCG
  • BKK23210 ([gene|9137D162E6331E2B127472BCF5F49A9AE46266F3|scpB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATAGCTTTCCAATTCA, downstream forward: _UP4_TAGAAGTTTAATGAATCGCG
  • References


  • 22933559,22934648,24118085,25460803,26706151,29182912,27075410
  • Original publications

  • 12100548,12065423,12421306,22385855,16479537,19450516,12897137,7934830,11948165,23353789,24440399,24440393,25071173,25557547,25951515,26253537,23475963,26295962,26725510,26904953,28189581,28154080,28286005,28689660,30192981,31201090,31175837,32250245