SubtiBank SubtiBank
scpB
The papers of the month are back! Check them out! Link here

scpB

part of the [SW|condensin] complex, chromosomal origin condensation and segregation
locus
BSU23210
pI
4.25
mw
21.89 kDa
protein length
197 aa Sequence Blast
gene length
591 bp Sequence Blast
function
segregation of replication origins
product
DNA segregation and condensation protein
essential
yes
synonyms
ypuH

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.3|DNA condensation/ segregation]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • Gene

    Coordinates
    2,425,248 → 2,425,841

    Phenotypes of a mutant

  • essential [Pubmed|24440399], non-essential according to [Pubmed|28189581]
  • ''[gene|9137D162E6331E2B127472BCF5F49A9AE46266F3|scpB]'' mutants are not viable on complex medim that allow rapid growth, but they are viable under conditions of slow growth [Pubmed|24440399,24440393]
  • The protein

    Catalyzed reaction/ biological activity

  • negatively regulates binding of the [protein|8DD968C97FDC0E81293887E2FCB7EE1A9416A333|ScpA] NTD to the [protein|0136394A52759CEEDD8DE074ED74033C6FFB8435|Smc] neck region [pubmed|28286005]
  • Protein family

  • scpB family (according to Swiss-Prot)
  • Structure

  • [PDB|4I98] (complex between [protein|8DD968C97FDC0E81293887E2FCB7EE1A9416A333|ScpA] (aa 1-160)-[protein|9137D162E6331E2B127472BCF5F49A9AE46266F3|ScpB] (aa 1-183) [Pubmed|23353789]
  • [SW|Localization]

  • nucleoid (Multiple) [Pubmed|16479537]
  • the [SW|condensin] ([protein|0136394A52759CEEDD8DE074ED74033C6FFB8435|Smc])2-[protein|8DD968C97FDC0E81293887E2FCB7EE1A9416A333|ScpA]-[protein|9137D162E6331E2B127472BCF5F49A9AE46266F3|ScpB] complex is loaded by [protein|EF4BD49FCD49EE97908973581478951C8FA196C0|ParB] to ''parS'' centromeric sites adjacent to the replication origin, travels then from the origin to the terminus at rates >50 kb per minute [Pubmed|28154080,24440393,23475963]
  • Expression and Regulation

    Operons

    genes
    [gene|8DD968C97FDC0E81293887E2FCB7EE1A9416A333|scpA]-[gene|9137D162E6331E2B127472BCF5F49A9AE46266F3|scpB]-[gene|3CC628BCF8F9F45E598060B775008B361DB2127A|ypuI]
    description
    [Pubmed|7934830]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|search|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A105 (ypuH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/105 NBRP B. subtilis, Japan]
  • BKE23210 (Δ[gene|9137D162E6331E2B127472BCF5F49A9AE46266F3|scpB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATAGCTTTCCAATTCA, downstream forward: _UP4_TAGAAGTTTAATGAATCGCG
  • BKK23210 (Δ[gene|9137D162E6331E2B127472BCF5F49A9AE46266F3|scpB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATAGCTTTCCAATTCA, downstream forward: _UP4_TAGAAGTTTAATGAATCGCG
  • References

    Reviews

  • 22933559,22934648,24118085,25460803,26706151
  • Original publications

  • 12100548,12065423,12421306,22385855,16479537,19450516,12897137,7934830,11948165,23353789,24440399,24440393,25071173,25557547,25951515,26253537,23475963,26295962,26725510,26904953,28189581,28154080,28286005,28689660