SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


31.64 kDa
protein length
300 aa Sequence Blast
gene length
903 bp Sequence Blast

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,998,796 2,999,698

    The protein

    Protein family

  • [SW|4-toluene sulfonate uptake permease (TSUP) (TC 2.A.102) family] (according to UniProt)
  • [SW|Localization]

  • membrane (Heterogeneous) [Pubmed|16479537]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15272571], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16109943], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|741156D495BE3857683C8A0390764EAD83845ABC|AscR]: activation, [Pubmed|16109943], in [regulon|741156D495BE3857683C8A0390764EAD83845ABC|AscR regulon]
  • regulation

  • induced in the presence of methionine and taurine [Pubmed|11390694]
  • view in new tab

    Biological materials


  • MGNA-A153 (ytnM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29280 ([gene|910EAAF48C85D0364751EC9585121246AF677431|ytnM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATCAGAACACCCCATC, downstream forward: _UP4_TAAAGGTTTTTCCGCTTTAC
  • BKK29280 ([gene|910EAAF48C85D0364751EC9585121246AF677431|ytnM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATCAGAACACCCCATC, downstream forward: _UP4_TAAAGGTTTTTCCGCTTTAC
  • References

  • 16109943,15668000,16479537,23944997