SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


31.64 kDa
protein length
300 aa Sequence Blast
gene length
903 bp Sequence Blast

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,998,796 2,999,698

    The protein

    Protein family

  • [SW|4-toluene sulfonate uptake permease (TSUP) (TC 2.A.102) family] (according to UniProt)
  • [SW|Localization]

  • membrane (Heterogeneous) [Pubmed|16479537]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15272571], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16109943], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|741156D495BE3857683C8A0390764EAD83845ABC|AscR]: activation, [Pubmed|16109943], in [regulon|741156D495BE3857683C8A0390764EAD83845ABC|AscR regulon]
  • regulation

  • induced in the presence of methionine and taurine [Pubmed|11390694]
  • view in new tab

    Biological materials


  • MGNA-A153 (ytnM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29280 ([gene|910EAAF48C85D0364751EC9585121246AF677431|ytnM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATCAGAACACCCCATC, downstream forward: _UP4_TAAAGGTTTTTCCGCTTTAC
  • BKK29280 ([gene|910EAAF48C85D0364751EC9585121246AF677431|ytnM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATCAGAACACCCCATC, downstream forward: _UP4_TAAAGGTTTTTCCGCTTTAC
  • References

  • 16109943,15668000,16479537,23944997