SubtiBank SubtiBank
ytnM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytnM

unknown
locus
BSU_29280
pI
10.15
mw
31.64 kDa
protein length
300 aa Sequence Blast
gene length
903 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,998,796 2,999,698

    The protein

    Protein family

  • [SW|4-toluene sulfonate uptake permease (TSUP) (TC 2.A.102) family] (according to UniProt)
  • [SW|Localization]

  • membrane (Heterogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|E3F1B3A4086DBC40FD9AE9CD6981270FBDFA6CAF|snaA]-[gene|A6A13C54177381CE78ABA2CFC2A3F2CE12099F15|tcyJ]-[gene|A8FA40EACDB15CF53DDDA725A3AA5A6EB654FA8B|tcyK]-[gene|350C97E4A4C60A6E2FF9610D50B4A49FB9F9B42D|tcyL]-[gene|B1DD32A3B3D1C0C5391A40834940257357A2F30F|tcyM]-[gene|B24763A732111026D21C828FF9BE73FB22A123CF|tcyN]-[gene|EDC3565D90D7059A4A4C66A13EB568420F6CECD4|cmoO]-[gene|FCD25CA4414D689B217F54B0C44EB805F9590454|cmoI]-[gene|8145952307BC47805A7A9BD39418474358043BFE|cmoJ]-[gene|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]-[gene|0DE66A10D9475DC57A140561E8532D3EC038FD6F|sndA]-[gene|910EAAF48C85D0364751EC9585121246AF677431|ytnM]
    description
    [Pubmed|15668000]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15272571], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16109943], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|741156D495BE3857683C8A0390764EAD83845ABC|AscR]: activation, [Pubmed|16109943], in [regulon|741156D495BE3857683C8A0390764EAD83845ABC|AscR regulon]
  • regulation

  • induced in the presence of methionine and taurine [Pubmed|11390694]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A153 (ytnM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/153 NBRP B. subtilis, Japan]
  • BKE29280 ([gene|910EAAF48C85D0364751EC9585121246AF677431|ytnM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATCAGAACACCCCATC, downstream forward: _UP4_TAAAGGTTTTTCCGCTTTAC
  • BKK29280 ([gene|910EAAF48C85D0364751EC9585121246AF677431|ytnM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATCAGAACACCCCATC, downstream forward: _UP4_TAAAGGTTTTTCCGCTTTAC
  • References

  • 16109943,15668000,16479537,23944997