SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|MarR family|MarR/DUF24 family] transcription regulator, positively controls the nitroreductase gene [gene|9DF5999568760E016ECA988385A1FA61A257D486|hypO] in response to disulfide stress
14.59 kDa
protein length
125 aa Sequence Blast
gene length
378 bp Sequence Blast
control of the nitroreductase gene [gene|9DF5999568760E016ECA988385A1FA61A257D486|hypO] in response to disulfide stress (diamide, NaOCl)
[SW|MarR family|MarR/DUF24 family] transcription regulator HypR

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    4,167,622 4,167,999

    The protein

    Protein family

  • [SW|MarR family|MarR/DUF24 family]
  • Paralogous protein(s)

  • [protein|C57DDC9710CB557179B062F9C5D786DB02A3B5FC|YkvN], [protein|D9A187961CFB9496A6712E9E48AAD384357A3E1C|HxlR], [protein|E757C4B329A99E3D0C70C77437DF4DDA300CA5E7|YdzF], [protein|51B1913B59C1876CCED4A88414797B3A22BE4E3C|YdeP], [protein|1E74F0557FF9ECB404B6544831F4E0A162473423|YtcD], [protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB]
  • Kinetic information

  • Cys14 redox sensing Cys, has lower pKa of 6.36 [Pubmed|22238377]
  • [SW|Domains]

  • 5 alpha helices, 2 beta sheets, MarR-fold with wHTH motif, alpha4 major groove recognition helix, beta2 and 3 form the wing; alpha5 dimer interface [Pubmed|22238377]
  • [SW|HTH hxlR-type domain] (aa 14-112) (according to UniProt)
  • Modification

  • oxidized to Cys14-Cys49' intersubunit disulfides by disulfide stress [Pubmed|22238377]
  • Cys14 and Cys49' are about 8-9 Angstrm apart in reduced HypR-Dimer, oxidation moves the major groove recognition alpha4 helices of the HypR dimer about 4 Angstroem towards each other that leads to activation of HypR [Pubmed|22238377]
  • Structure

  • [PDB|4A5N] (reduced HypRC14S dimer) [Pubmed|22238377]
  • [PDB|4A5M] (oxidized HypR C14-C49' intersubunit disulfide-linked dimer ) [Pubmed|22238377]
  • [SW|Localization]

  • cytoplasmic
  • Expression and Regulation



    regulatory mechanism

  • [protein|91085DA5E71B88E533D2E1D1BFB53E908116C6AA|HypR]: activation, (autoregulation)[Pubmed|22238377], in [regulon|91085DA5E71B88E533D2E1D1BFB53E908116C6AA|HypR regulon]
  • regulation

  • activated by disulfide stress conditions (diamide, NaOCl) ''in vivo'' and ''in vitro '' (autoregulation) [Pubmed|22238377]
  • view in new tab

    Biological materials


  • MGNA-B836 (yybR::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE40540 ([gene|91085DA5E71B88E533D2E1D1BFB53E908116C6AA|hypR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTGACCCTCCAATAG, downstream forward: _UP4_TAGCAGCAAAGGGAACTCCT
  • BKK40540 ([gene|91085DA5E71B88E533D2E1D1BFB53E908116C6AA|hypR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTGACCCTCCAATAG, downstream forward: _UP4_TAGCAGCAAAGGGAACTCCT
  • labs

  • [SW|Haike Antelmann],University of Greifswald, Germany