SubtiBank SubtiBank
ypzH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypzH

unknown
locus
BSU_22849
pI
6.03
mw
7.20 kDa
protein length
gene length
195 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,391,670 2,391,864

    Expression and Regulation

    Operons

    genes
    [gene|5DA8B27AC6A0E0B4115512BD948C31964D387A8E|yphA]-[gene|448375DF74EB0482A6CD1ACFE04D117C1319E2B2|seaA]-[gene|910109496E4A41EC892996DEEB81971FCBD9CB05|ypzH]-[gene|B2270316642C66BC2DA86EBDCD1BF6A33CC6A1DC|yphC]-[gene|8440C1DBE485BB9EF2904FAA5D709A574C3819A4|gpsA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE22849 ([gene|910109496E4A41EC892996DEEB81971FCBD9CB05|ypzH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22849 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCACTTTCGTAAGAGATT, downstream forward: _UP4_TAAGAATAGTTGTGATCCCA
  • BKK22849 ([gene|910109496E4A41EC892996DEEB81971FCBD9CB05|ypzH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22849 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCACTTTCGTAAGAGATT, downstream forward: _UP4_TAAGAATAGTTGTGATCCCA