SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


transcription repressor of class III heat shock genes ([gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC] operon, [gene|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE], [gene|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP])
17.60 kDa
protein length
154 aa Sequence Blast
gene length
465 bp Sequence Blast
regulation of protein degradation
transcription repressor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    101,449 101,913

    Phenotypes of a mutant

  • reduced expression of [gene|1BC439BBCD5FE19D5780519D7E4317C2EFF0D21B|trxB], due to reduced [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] activity [pubmed|30962353]
  • The protein

    Protein family

  • CtsR family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-55 (phosphorylation serves as tag for degradation by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]) [Pubmed|27749819]
  • phosphorylation of a tyrosine residue by [protein|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|McsB] [Pubmed|14984053]
  • recently, it was reported that CtsR is phosphorylated by [protein|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|McsB] on Arg-62 rather than on a tyrosine residue [Pubmed|19498169]
  • in addition, Arg-15 was reported to be a phosphorylation site [Pubmed|22517742]
  • Effectors of protein activity

  • CtsR is inactivated by heat, heat sensing requires Gly-64 [Pubmed|20852588]
  • non-phosphorylated [protein|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|McsB] targets CtsR for degradation [Pubmed|20852588]
  • regulated proteolysis by [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]/[protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] [Pubmed|11179229,16163393,17380125]
  • Structure

  • [PDB|3H0D] (complex with a 26bp DNA duplex, from ''Geobacillus stearothermophilus'') [Pubmed|19498169]
  • [PDB|6FH4] (C-terminal domain bound to phosphoarginine) [pubmed|30962626]
  • additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [pubmed|17981983]
  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8793870], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|8793870] [pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [pubmed|9987115,11179229,16163393,17380125], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [pubmed|30962353], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • expressed during germination and spore outgrowth [Pubmed|24244006]
  • induction during diamide stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]) [pubmed|30962353]
  • view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials


  • MGNA-B928 (yacG::erm), available at the [ NBRP B. subtilis, Japan]
  • ''ctsR::aphA3'' availbale in [SW|Ulf Gerth]'s lab
  • BKE00830 (''[gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE00830 ([gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCAACCCCCTCCTTTAC, downstream forward: _UP4_AAATTAAAATAAGCGGGTGA
  • BKK00830 ([gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCAACCCCCTCCTTTAC, downstream forward: _UP4_AAATTAAAATAAGCGGGTGA
  • Expression vectors

  • for expression, purification in E. coli with N-terminal His-tag, pRSETA available in [SW|Ulf Gerth]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Ulf Gerth]'s lab
  • References


  • 14984053,21078442,23375660,27518094,28402413,28748186
  • Original Publications

  • 27749819,30962626,30962353,11179229,20852588