SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


succinate dehydrogenase
28.27 kDa
protein length
253 aa Sequence Blast
gene length
762 bp Sequence Blast
TCA cycle
succinate dehydrogenase (iron-sulfur protein)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|TCA cycle]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,905,571 2,906,332

    The protein

    Catalyzed reaction/ biological activity

  • Succinate acceptor = fumarate reduced acceptor (according to Swiss-Prot)
  • Protein family

  • succinate dehydrogenase/fumarate reductase iron-sulfur protein family (according to Swiss-Prot)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Effectors of protein activity

  • Inhibited by 2-(n-Heptyl)-4-hydroxy-quinoline N-oxide [Pubmed|3910107]
  • Activated by Cytochrome b558 [Pubmed|6799760]
  • Structure

  • [PDB|1NEK] (''E. coli'') [pubmed|12560550]
  • [SW|Localization]

  • attached to the membrane [Pubmed|18763711]
  • Additional information

  • This enzyme is a trimer membrane-bound [Pubmed|3910107] [Pubmed|6799760]
  • One subunit is bound to citochrome b558, and this subunit is the one bound to the cytosolic side of the membrane [Pubmed|3910107] [Pubmed|6799760]
  • Another subunit is the flavoprotein one, required for FAD usage [Pubmed|3910107] [Pubmed|6799760]
  • The other subunit has an iron-sulphur domain necessary for the catalytic activity [Pubmed|3910107] [Pubmed|6799760]
  • extensive information on the structure and enzymatic properties of succinate dehydrogenase can be found at [ Proteopedia]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2495271], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutive
  • view in new tab

    Other regulations

  • [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation inhibition, [Pubmed|22389480]
  • Biological materials


  • GP792 ∆(''[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]-[gene|901F90AFC94CC7140709845333416106D043269D|sdhB]'')::''phleo'', available in [SW|Jörg Stülke]'s lab
  • GP2342 ∆(''[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]-[gene|901F90AFC94CC7140709845333416106D043269D|sdhB]'')::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • GP2343 ∆(''[gene|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|sdhC]-[gene|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|sdhA]-[gene|901F90AFC94CC7140709845333416106D043269D|sdhB]'')::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • BKE28430 ∆([gene|901F90AFC94CC7140709845333416106D043269D|sdhB])::erm trpC2 available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATGGTTTTTTGTTCACTCA, downstream forward: _UP4_TAAGAAGAAAAAACCTCTTC
  • BKK28430 ∆([gene|901F90AFC94CC7140709845333416106D043269D|sdhB])::kan trpC2 available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATGGTTTTTTGTTCACTCA, downstream forward: _UP4_TAAGAAGAAAAAACCTCTTC
  • GFP fusion

  • GP1436 (spc, based on [SW|pGP1870]), available in the [SW|Stülke] lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Stülke] lab
  • FLAG-tag construct

  • GP1426 (spc, based on [SW|pGP1331]), available in the [SW|Stülke] lab
  • Antibody

  • **
  • References


  • 11803018
  • Original publications

  • 1707123,6401289,1324713,3036777,2495271,3027051,7748886,2837411,12560550,3910107,6799760,22389480,23880299,12560550