SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


23.02 kDa
protein length
208 aa Sequence Blast
gene length
627 bp Sequence Blast

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of pectin]
  • Gene

    769,487 770,113

    Expression and Regulation



    regulatory mechanism

  • [protein|BF0E202739BFD461E418655ECD9C3425AC556FA3|RhgR]: activation, [Pubmed|19651770], in [regulon|BF0E202739BFD461E418655ECD9C3425AC556FA3|RhgR regulon]
  • regulation

  • induced by pectin ([protein|search|RhgR]) [Pubmed|19651770]
  • view in new tab

    Biological materials


  • MGNA-B453 (yesV::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07040 ([gene|8FE909876A7A21B436CA0CFB90ED190BAD17C8E1|yesV]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGCGCATCCGTTACAGTCG, downstream forward: _UP4_TAACAAAAAAATGACAAATA
  • BKK07040 ([gene|8FE909876A7A21B436CA0CFB90ED190BAD17C8E1|yesV]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGCGCATCCGTTACAGTCG, downstream forward: _UP4_TAACAAAAAAATGACAAATA
  • References

  • 19651770,17449691