SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


signal peptidase II
17.28 kDa
protein length
154 aa Sequence Blast
gene length
465 bp Sequence Blast
protein secretion
signal peptidase II

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,616,744 1,617,208

    The protein

    Catalyzed reaction/ biological activity

  • Release of signal peptides from bacterial membrane prolipoproteins. Hydrolyzes -Xaa-Yaa-Zaa-|-(S,diacylglyceryl)Cys-, in which Xaa is hydrophobic (preferably Leu), and Yaa (Ala or Ser) and Zaa (Gly or Ala) have small, neutral side chains (according to UniProt)
  • Protein family

  • peptidase A8 family (single member, according to UniProt)
  • Structure

  • [PDB|5DIR] (from Pseudomonas aeruginosa, 38% identity), [pubmed|26912896]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE15450 ([gene|8FC1A0A6C9975F6C125490FBAAB2A4957210A9F1|lspA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAACGTTCCTCCAGTTT, downstream forward: _UP4_GGGAAAAAGAAAAAGGAGCA
  • BKK15450 ([gene|8FC1A0A6C9975F6C125490FBAAB2A4957210A9F1|lspA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAACGTTCCTCCAGTTT, downstream forward: _UP4_GGGAAAAAGAAAAAGGAGCA
  • References

  • 9882689,10497172,9880550,26912896