SubtiBank SubtiBank
lspA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lspA

signal peptidase II
locus
BSU_15450
pI
9.13
mw
17.28 kDa
protein length
154 aa Sequence Blast
gene length
465 bp Sequence Blast
function
protein secretion
product
signal peptidase II
essential
no
ec
3.4.23.36
synonyms
lsp

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,616,744 1,617,208

    The protein

    Catalyzed reaction/ biological activity

  • Release of signal peptides from bacterial membrane prolipoproteins. Hydrolyzes -Xaa-Yaa-Zaa-|-(S,diacylglyceryl)Cys-, in which Xaa is hydrophobic (preferably Leu), and Yaa (Ala or Ser) and Zaa (Gly or Ala) have small, neutral side chains (according to UniProt)
  • Protein family

  • peptidase A8 family (single member, according to UniProt)
  • Structure

  • [PDB|5DIR] (from Pseudomonas aeruginosa, 38% identity), [pubmed|26912896]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|8FC1A0A6C9975F6C125490FBAAB2A4957210A9F1|lspA]-[gene|C8C2E2F1B739F3D9A2FA6B460998708AAB2DA495|ylyB]-[gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE15450 ([gene|8FC1A0A6C9975F6C125490FBAAB2A4957210A9F1|lspA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAACGTTCCTCCAGTTT, downstream forward: _UP4_GGGAAAAAGAAAAAGGAGCA
  • BKK15450 ([gene|8FC1A0A6C9975F6C125490FBAAB2A4957210A9F1|lspA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAACGTTCCTCCAGTTT, downstream forward: _UP4_GGGAAAAAGAAAAAGGAGCA
  • References

  • 9882689,10497172,9880550,26912896