SubtiBank SubtiBank
bioI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bioI

cytochrome P450 enzyme
locus
BSU_30190
pI
6.20
mw
44.70 kDa
protein length
395 aa Sequence Blast
gene length
1188 bp Sequence Blast
function
biosynthesis of biotin
product
cytochrome P450 enzyme
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.1|Biosynthesis/ acquisition of biotin]
  • Gene

    Coordinates
    3,089,226 3,090,413

    The protein

    Catalyzed reaction/ biological activity

  • formation of pimelic acid via a multiple-step oxidative cleavage of long-chain fatty acids
  • C2-C8-saturated long-chain fatty acyl-[ACP] + 3 O2 + 2 reduced [flavodoxin] --> fatty aldehyde + 3 H+ + 3 H2O + 2 oxidized [flavodoxin] + pimeloyl-[ACP] (according to UniProt)
  • Protein family

  • [SW|cytochrome P450] family (according to UniProt)
  • Paralogous protein(s)

  • [protein|A95C28DEE73AD25E28C45B88A7C03C92835F9705|CypA], [protein|D8E72C2523D5E6214C9CBAC2C1B27EA45378E162|YjiB], [protein|EF0F13BB682791E167EFC350BF029B08E8A1F410|PksS]
  • Structure

  • [PDB|3EJB], [PDB|3EJE] (complex with [protein|8D260693D0C69442BCB9F3D8480E8425ACFE34D2|AcpA]) [Pubmed|18838690]
  • Expression and Regulation

    Operons

    genes
    [gene|C40116089BAD3F9831F8C837DC4F2E045753ABDE|bioW]-[gene|68C86FED3575B864C576DFB73FE7B5BF83994D1F|bioA]-[gene|8B6A3E86A88928526D94FDA94B9C81ABF6E9ACFB|bioF]-[gene|D9A71DAF949FB6C9C22C8361D83C5A0741184977|bioD]-[gene|5880617EB95FC0D19219A868D6D0A3D1D0D9C532|bioB]-[gene|8FBC9A1AC108DC99E275D7A27C18C797D3CDB936|bioI]-[gene|089A32D08B5A7E552CBD9CB9745BD542863B4558|ytbQ]
    description
    [Pubmed|8763940,8892842]

    regulatory mechanism

  • [protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA]: repression, [Pubmed|8763940,8892842], in [regulon|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA regulon]
  • regulation

  • repressed in the presence of biotin ([protein|search|BirA]) [Pubmed|8763940,8892842]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A804 (bioI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/804 NBRP B. subtilis, Japan]
  • BKE30190 ([gene|8FBC9A1AC108DC99E275D7A27C18C797D3CDB936|bioI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTGATTTTCTCCTTTCT, downstream forward: _UP4_TAAGCCTAAGAATGTGAGTG
  • BKK30190 ([gene|8FBC9A1AC108DC99E275D7A27C18C797D3CDB936|bioI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTGATTTTCTCCTTTCT, downstream forward: _UP4_TAAGCCTAAGAATGTGAGTG
  • References

    Reviews

  • 21437340
  • Original publications

  • 18838690,8763940,8892842,15449931,15449930,12538057,20658980,11368323,11472016,14737344,12943422,28196402,28898812