SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


cytochrome P450 enzyme
44.70 kDa
protein length
395 aa Sequence Blast
gene length
1188 bp Sequence Blast
biosynthesis of biotin
cytochrome P450 enzyme

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis/ acquisition of biotin]
  • Gene

    3,089,226 3,090,413

    The protein

    Catalyzed reaction/ biological activity

  • formation of pimelic acid via a multiple-step oxidative cleavage of long-chain fatty acids
  • Protein family

  • [SW|cytochrome P450] family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|A95C28DEE73AD25E28C45B88A7C03C92835F9705|CypA], [protein|D8E72C2523D5E6214C9CBAC2C1B27EA45378E162|YjiB], [protein|EF0F13BB682791E167EFC350BF029B08E8A1F410|PksS]
  • Structure

  • [PDB|3EJB], [PDB|3EJE] (complex with [protein|8D260693D0C69442BCB9F3D8480E8425ACFE34D2|AcpA]) [Pubmed|18838690]
  • Expression and Regulation



    regulatory mechanism

  • [protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA]: repression, [Pubmed|8763940,8892842], in [regulon|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA regulon]
  • regulation

  • repressed in the presence of biotin ([protein|search|BirA]) [Pubmed|8763940,8892842]
  • view in new tab

    Biological materials


  • MGNA-A804 (bioI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30190 ([gene|8FBC9A1AC108DC99E275D7A27C18C797D3CDB936|bioI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTGATTTTCTCCTTTCT, downstream forward: _UP4_TAAGCCTAAGAATGTGAGTG
  • BKK30190 ([gene|8FBC9A1AC108DC99E275D7A27C18C797D3CDB936|bioI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTGATTTTCTCCTTTCT, downstream forward: _UP4_TAAGCCTAAGAATGTGAGTG
  • References


  • 21437340
  • Original publications

  • 18838690,8763940,8892842,15449931,15449930,12538057,20658980,11368323,11472016,14737344,12943422,28196402,28898812