SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


26.38 kDa
protein length
244 aa Sequence Blast
gene length
735 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    1,098,412 1,099,146

    The protein

    Protein family

  • [SW|metallo-beta-lactamase superfamily] (according to UniProt)
  • [SW|Cofactors]

  • Manganese [pubmed|31481231]
  • Structure

  • [PDB|6KNS] (space group I4122)
  • [PDB|6KNT] (space group P4332)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE10240 ([gene|8FA225FA26DB0B89812A835EB928F2C8892EBC89|yhfI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGTCCTCCTATCTTT, downstream forward: _UP4_TGGGAAGGATAAAGGAGGAG
  • BKK10240 ([gene|8FA225FA26DB0B89812A835EB928F2C8892EBC89|yhfI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGTCCTCCTATCTTT, downstream forward: _UP4_TGGGAAGGATAAAGGAGGAG
  • References

    Research papers

  • 31481231