SubtiBank SubtiBank
pghZ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

pghZ

phage-derived gamma polyglutamic acid hydrolase
locus
BSU_20460
pI
8.59
mw
30.21 kDa
protein length
274 aa Sequence Blast
gene length
825 bp Sequence Blast
function
polyglutamic acid degradation
product
phage-derived gamma polyglutamic acid hydrolase
essential
no
synonyms
yoqZ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.4|Capsule biosynthesis and degradation]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,189,961 2,190,785

    The protein

    Catalyzed reaction/ biological activity

  • hydrolysis of polyglutamic acid [Pubmed|26158264]
  • Protein family

  • [SW|UPF0714 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|BA7D1D112E934B68073DFC1F76248ED6157240E3|PghB], [protein|DF95DED9A6E2160C151D7664C951B198EEA225E8|PghC], [protein|FD862CE6C4A37B17714F8F8687B3266D43EF5F63|PghL]
  • [SW|Domains]

  • DUF867 [http://pfam.xfam.org/family/PF05908 x], [[gamma-PGA hydrolase domain]] [Pubmed|26158264]
  • Structure

  • [PDB|3A9L] (from B. subtilis phage NIT1, 43% identity) [pubmed|22105902]
  • Biological materials

    Mutant

  • BKE20460 ([gene|8F9DCD77660706E4D25CD7875C014F6A2B5D8123|pghZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCAACAACTCTCCTTAA, downstream forward: _UP4_TATTGTATGGCTGGTGTAGC
  • BKK20460 ([gene|8F9DCD77660706E4D25CD7875C014F6A2B5D8123|pghZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCAACAACTCTCCTTAA, downstream forward: _UP4_TATTGTATGGCTGGTGTAGC
  • References

  • 20525796,26158264,22105902