SubtiBank SubtiBank
ddcA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ddcA

DNA damage checkpoint antagonist, prevents [protein|7BF591DCDC9635C605D76135481A8A9DB63EE861|YneA]-dependent cell elongation
locus
BSU_28240
pI
4.39
mw
35.70 kDa
protein length
334 aa Sequence Blast
gene length
1005 bp Sequence Blast
function
control of [protein|7BF591DCDC9635C605D76135481A8A9DB63EE861|YneA] activity
product
DNA damage checkpoint antagonist
essential
no
synonyms
ysoA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes]
  • Gene

    Coordinates
    2,887,817 2,888,821

    Phenotypes of a mutant

  • sensitive to DNA damage exposure, this can be rescued by deletion of [gene|7BF591DCDC9635C605D76135481A8A9DB63EE861|yneA] [pubmed|30315724]
  • The protein

    [SW|Domains]

  • three [SW|TPR repeat|tetratrichopeptide repeats] [pubmed|30315724]
  • [SW|Localization]

  • cytosol [pubmed|30315724]
  • Biological materials

    Mutant

  • MGNA-A995 (ysoA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/995 NBRP B. subtilis, Japan]
  • BKE28240 ([gene|8F8CFC1F80227BA791AAAB884E6485C27A78C31A|ddcA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCTATATTCCTTTCAG, downstream forward: _UP4_TAAATCGCGCCATATAGTTG
  • BKK28240 ([gene|8F8CFC1F80227BA791AAAB884E6485C27A78C31A|ddcA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCTATATTCCTTTCAG, downstream forward: _UP4_TAAATCGCGCCATATAGTTG
  • References

    Research papers

  • 30315724