SubtiBank SubtiBank
spoIIIL
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

spoIIIL

component of the [protein|search|SpoIIIA]-[protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] trans-envelope complex, required for the activation of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]
locus
BSU_24660
pI
10.58
mw
9.62 kDa
protein length
gene length
180 bp Sequence Blast
function
activation of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]
product
component of the [protein|search|SpoIIIA]-[protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] trans-envelope complex
essential
no
synonyms
yqzE

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • Gene

    Coordinates
    2,555,887 2,556,066

    Phenotypes of a mutant

  • reduced [SW|sporulation] efficiency (14% compared to wild type) [Pubmed|26735940]
  • the ''[gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL] [gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]'' double mutant has a severe [SW|sporulation] defect (0.001%) [Pubmed|26735940]
  • The protein

    [SW|Localization]

  • forespore [Pubmed|26735940]
  • Expression and Regulation

    Operons

    genes
    [gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]-[gene|EA1C841FC77A1994A85E2E0C0A554482C3EC9323|comGB]-[gene|19D76B80386F825109C5FB4A34881D5D20F366DB|comGC]-[gene|D323AEF5AFB4FD2A074ABAB76A39BE26A4C6436F|comGD]-[gene|FF4DB7FDCEB440064E11E65CB0DBFB93FC785CF0|comGE]-[gene|DD266DC0D78B5C5E82EED7CC7F55D0CF8FB4BF7A|comGF]-[gene|89442BFDFBFF264D0C7F12DEA6F8130C55D1F3F8|comGG]-[gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL]
    description
    [Pubmed|26735940,2507524]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2507524], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|26735940], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8196543], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|26735940]
  • additional information

  • the ''[SW|comGA]-[SW|comGB]-[SW|comGC]-[SW|comGD]-[SW|comGE]-[SW|comGF]-[SW|comGG]-[protein|search|spoIIIL]'' operon requires [SW|NusA] for expression [http://www.nature.com/articles/nmicrobiol20157 Reference]
  • view in new tab

    genes
    [gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL]
    description
    [Pubmed|26735940]

    regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|26735940]
  • additional information

  • the ''[SW|comGA]-[SW|comGB]-[SW|comGC]-[SW|comGD]-[SW|comGE]-[SW|comGF]-[SW|comGG]-[protein|search|spoIIIL]'' operon requires [SW|NusA] for expression [http://www.nature.com/articles/nmicrobiol20157 Reference]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C472 (yqzE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2470 NBRP B. subtilis, Japan]
  • BKE24660 ([gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTGATCACCTCATCATT, downstream forward: _UP4_TAACCGCAAATAAACGAATA
  • BKK24660 ([gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTGATCACCTCATCATT, downstream forward: _UP4_TAACCGCAAATAAACGAATA
  • References

    Reviews

  • 31350897
  • Original Publications

  • 2507524,23033921,12107147,8196543,26735940