SubtiBank SubtiBank
ahpF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ahpF

alkyl hydroperoxide reductase (large subunit) / NADH dehydrogenase
locus
BSU40100
pI
4.70
mw
54.71 kDa
protein length
509 aa Sequence Blast
gene length
1530 bp Sequence Blast
function
resistance against peroxide stress
product
alkyl hydroperoxide reductase (large subunit) / NADH dehydrogenase
essential
no
ec
1.6.99.3
synonyms
ndh

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]
  • Gene

    Coordinates
    4,119,527 4,121,056

    The protein

    Catalyzed reaction/ biological activity

  • NADH + acceptor = NAD+ + reduced acceptor (according to Swiss-Prot)
  • Protein family

  • class-II pyridine nucleotide-disulfide oxidoreductase family (according to Swiss-Prot)
  • Modification

  • phosphorylation on (Ser-48 OR Ser-49) [Pubmed|17218307]
  • phosphorylated on Arg-457 [Pubmed|22517742]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|1HYU] (from ''Salmonella typhimurium'', 52% identity, 69% similarity) [Pubmed|11300769]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|D0982500E52577D52FADF775C0E512A4B9657B79|ahpC]-[gene|8F23B575BC32EA63267C4321DD8E4BD546B11AF1|ahpF]
    description
    [Pubmed|8932314]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8932314], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|11532148], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • induced by H2O2 ([protein|search|PerR]) [Pubmed|11532148]
  • view in new tab

    Biological materials

    Mutant

  • GP1730 [gene|search|ahpCF]::mls trpC2 available in [SW|Jörg Stülke]'s lab
  • BKE40100 ([gene|8F23B575BC32EA63267C4321DD8E4BD546B11AF1|ahpF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAAGTACCAATTGAATGC, downstream forward: _UP4_TAATATAAGAAATCCGCTAT
  • BKK40100 ([gene|8F23B575BC32EA63267C4321DD8E4BD546B11AF1|ahpF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAAGTACCAATTGAATGC, downstream forward: _UP4_TAATATAAGAAATCCGCTAT
  • References

  • 11532148,16232966,8932314,8932315,11532148,17218307,22517742,15581580