SubtiBank SubtiBank
ahpF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ahpF

alkyl hydroperoxide reductase (large subunit) / NADH dehydrogenase
locus
BSU_40100
pI
4.70
mw
54.71 kDa
protein length
509 aa Sequence Blast
gene length
1530 bp Sequence Blast
function
resistance against peroxide stress
product
alkyl hydroperoxide reductase (large subunit) / NADH dehydrogenase
essential
no
ec
1.6.99.3
synonyms
ndh

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]
  • Gene

    Coordinates
    4,119,527 4,121,056

    The protein

    Catalyzed reaction/ biological activity

  • A + H+ + NADH --> AH2 + NAD+ (according to UniProt)
  • Protein family

  • class-II pyridine nucleotide-disulfide oxidoreductase family (with [protein|1BC439BBCD5FE19D5780519D7E4317C2EFF0D21B|TrxB], according to UniProt)
  • [SW|Domains]

  • Thioredoxin-like fold domain (aa 108-210) (according to InterPro)
  • Modification

  • phosphorylation on (Ser-48 OR Ser-49) [Pubmed|17218307]
  • phosphorylated on Arg-457 [Pubmed|22517742]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|1HYU] (from ''Salmonella typhimurium'', 52% identity, 69% similarity) [Pubmed|11300769]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|D0982500E52577D52FADF775C0E512A4B9657B79|ahpC]-[gene|8F23B575BC32EA63267C4321DD8E4BD546B11AF1|ahpF]
    description
    [Pubmed|8932314]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8932314], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|11532148], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • induced by H2O2 ([protein|search|PerR]) [Pubmed|11532148]
  • view in new tab

    Biological materials

    Mutant

  • GP1730 [gene|search|ahpCF]::mls trpC2 available in [SW|Jörg Stülke]'s lab
  • BKE40100 ([gene|8F23B575BC32EA63267C4321DD8E4BD546B11AF1|ahpF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAAGTACCAATTGAATGC, downstream forward: _UP4_TAATATAAGAAATCCGCTAT
  • BKK40100 ([gene|8F23B575BC32EA63267C4321DD8E4BD546B11AF1|ahpF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAAGTACCAATTGAATGC, downstream forward: _UP4_TAATATAAGAAATCCGCTAT
  • References

  • 11532148,16232966,8932314,8932315,11532148,17218307,22517742,15581580