SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


alkyl hydroperoxide reductase (large subunit) / NADH dehydrogenase
54.71 kDa
protein length
509 aa Sequence Blast
gene length
1530 bp Sequence Blast
resistance against peroxide stress
alkyl hydroperoxide reductase (large subunit) / NADH dehydrogenase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]
  • Gene

    4,119,527 4,121,056

    The protein

    Catalyzed reaction/ biological activity

  • A + H+ + NADH --> AH2 + NAD+ (according to UniProt)
  • Protein family

  • class-II pyridine nucleotide-disulfide oxidoreductase family (with [protein|1BC439BBCD5FE19D5780519D7E4317C2EFF0D21B|TrxB], according to UniProt)
  • [SW|Domains]

  • Thioredoxin-like fold domain (aa 108-210) (according to InterPro)
  • Modification

  • phosphorylation on (Ser-48 OR Ser-49) [Pubmed|17218307]
  • phosphorylated on Arg-457 [Pubmed|22517742]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|1HYU] (from ''Salmonella typhimurium'', 52% identity, 69% similarity) [Pubmed|11300769]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8932314], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|11532148], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • induced by H2O2 ([protein|search|PerR]) [Pubmed|11532148]
  • view in new tab

    Biological materials


  • GP1730 [gene|search|ahpCF]::mls trpC2 available in [SW|Jörg Stülke]'s lab
  • BKE40100 ([gene|8F23B575BC32EA63267C4321DD8E4BD546B11AF1|ahpF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAAGTACCAATTGAATGC, downstream forward: _UP4_TAATATAAGAAATCCGCTAT
  • BKK40100 ([gene|8F23B575BC32EA63267C4321DD8E4BD546B11AF1|ahpF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAAGTACCAATTGAATGC, downstream forward: _UP4_TAATATAAGAAATCCGCTAT
  • References

  • 11532148,16232966,8932314,8932315,11532148,17218307,22517742,15581580