SubtiBank SubtiBank
cotJC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cotJC

polypeptide composition of the spore coat, may protect against oxidative stress
locus
BSU_06910
pI
4.90
mw
21.55 kDa
protein length
189 aa Sequence Blast
gene length
570 bp Sequence Blast
function
polypeptide composition of the spore coat, may protect against oxidative stress
product
putative manganese catalase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    756,417 756,986

    The protein

    Protein family

  • [SW|catalase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|01CE4BBBEB0C0855201D396FB8036F72B64EA7DD|YdbD], [protein|59EC45E8731FE989152553A69ACEF6569E88F85C|YjqC]
  • Structure

  • [PDB|1JKU] (from Lactobacillus plantarum, 34% identity) [pubmed|11587647]
  • Expression and Regulation

    Operons

    genes
    [gene|65A8D8D94E8E48DA28BA1F7BBB2FDBEB56A5EC72|cotJA]-[gene|536079E17C1CC18E77432D8006172D196B896EF8|cotJB]-[gene|8F21A4C6228A772B38597991AF43E6B0708339BF|cotJC]-[gene|E0DCE433B801FCEFF394ABAFE8CA73A0A0133257|yesJ]-[gene|FBE6C05AB3F3127F24C184B0E7F0165F372014D8|yesK]
    description
    [Pubmed|7768848]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|7768848,15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|7768848], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|7768848]
  • view in new tab

    Biological materials

    Mutant

  • BKE06910 ([gene|8F21A4C6228A772B38597991AF43E6B0708339BF|cotJC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCACATTCAGGCATTCC, downstream forward: _UP4_TAATAGGCAGATTGGCCTCT
  • BKK06910 ([gene|8F21A4C6228A772B38597991AF43E6B0708339BF|cotJC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCACATTCAGGCATTCC, downstream forward: _UP4_TAATAGGCAGATTGGCCTCT
  • References

    Reviews

  • 27227299
  • Original publications

  • 9364920,7768848,11587647