SubtiBank SubtiBank
ydgI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydgI

putative nitroreductase
locus
BSU_05660
pI
4.65
mw
23.21 kDa
protein length
209 aa Sequence Blast
gene length
630 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    612,191 612,820

    The protein

    Protein family

  • [SW|nitroreductase family] (according to UniProt)
  • Structure

  • [PDB|3GE6] (from Exiquobacterium sibiricum, 70% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|E8D1416DB588A4D72E84341F5EAB845E77A84792|ydgJ]-[gene|8EE3F368AB1CD4BB14E42135D63D27138D3FED03|ydgI]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C175 (ydgI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2173 NBRP B. subtilis, Japan]
  • BKE05660 ([gene|8EE3F368AB1CD4BB14E42135D63D27138D3FED03|ydgI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGATCATGTTGATACACTC, downstream forward: _UP4_TGCCGATTGATACAATTGCAG
  • BKK05660 ([gene|8EE3F368AB1CD4BB14E42135D63D27138D3FED03|ydgI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGATCATGTTGATACACTC, downstream forward: _UP4_TGCCGATTGATACAATTGCAG