SubtiBank SubtiBank
yabR [2018-05-18 15:22:33]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yabR [2018-05-18 15:22:33]

similar to polyribonucleotide nucleotidyltransferase
locus
BSU00630
pI
10.34
mw
14.05 kDa
protein length
128 aa Sequence Blast
gene length
384 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    69,626 → 70,012

    The protein

    Protein family

  • S1 motif domain (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|B0908BB4B8B569A7A78BB0B84784FD4C427C598B|YugI]: 51% identity
  • Expression and Regulation

    Operons

    genes
    [gene|D6B1837075ECBEE1FEAC704DDB6795336092897F|yabM]-[gene|52D48F22CB53421EE30970D34B4861E2F8A5893D|yabN]-[gene|B0CB19A3E3E84E12BF42BB050394C8A059A89359|yabO]-[gene|035B5486A3887FC71ACC0A8FB43ED77DC44E12EA|yabP]-[gene|4DEDB27C0162409571AB4A1BB17CFE400764AE45|yabQ]-[gene|FE0E60B875E72AEF5174A89C7AE5556FF59B19D5|divIC]-[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]
    description
    [Pubmed|11283287]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,11283287], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|12207695], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • expressed during sporulation ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|11283287]
  • view in new tab

    genes
    [gene|035B5486A3887FC71ACC0A8FB43ED77DC44E12EA|yabP]-[gene|4DEDB27C0162409571AB4A1BB17CFE400764AE45|yabQ]-[gene|FE0E60B875E72AEF5174A89C7AE5556FF59B19D5|divIC]-[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]
    description
    [Pubmed|11283287]

    regulation

  • expressed during sporulation ([protein|search|SigE]) [Pubmed|11283287]
  • additional information

  • there are about 50,000 molecules of DivIC per cell [http://www.ncbi.nlm.nih.gov/sites/entrez/9426141 PubMed]
  • view in new tab

    genes
    [gene|FE0E60B875E72AEF5174A89C7AE5556FF59B19D5|divIC]-[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]
    description
    [Pubmed|11283287]

    regulation

  • expressed during sporulation ([protein|search|SigE]) [Pubmed|11283287] and under stress conditions
  • additional information

  • there are about 50,000 molecules of DivIC per cell [http://www.ncbi.nlm.nih.gov/sites/entrez/9426141 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B919 (yabR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1918 NBRP B. subtilis, Japan]
  • BKE00630 (Δ[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAAGTGCTCCTCC, downstream forward: _UP4_TAACTTGCTGCTTTCTATAA
  • BKK00630 (Δ[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAAGTGCTCCTCC, downstream forward: _UP4_TAACTTGCTGCTTTCTATAA
  • References

  • 11283287,12207695