SubtiBank SubtiBank
yabR [2018-02-13 11:48:42]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yabR [2018-02-13 11:48:42]

similar to polyribonucleotide nucleotidyltransferase
14.05 kDa
protein length
128 aa Sequence Blast
gene length
384 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    69,626 → 70,012

    The protein

    Protein family

  • S1 motif domain (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|search|YugI ] (51%)
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,11283287], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|12207695], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • expressed during sporulation ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|11283287]
  • view in new tab



  • expressed during sporulation ([protein|search|SigE]) [Pubmed|11283287]
  • additional information

  • there are about 50,000 molecules of DivIC per cell [ PubMed]
  • view in new tab



  • expressed during sporulation ([protein|search|SigE]) [Pubmed|11283287] and under stress conditions
  • additional information

  • there are about 50,000 molecules of DivIC per cell [ PubMed]
  • view in new tab

    Biological materials


  • MGNA-B919 (yabR::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE00630 (Δ[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAAGTGCTCCTCC, downstream forward: _UP4_TAACTTGCTGCTTTCTATAA
  • BKK00630 (Δ[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAAGTGCTCCTCC, downstream forward: _UP4_TAACTTGCTGCTTTCTATAA
  • References

  • 11283287,12207695