SubtiBank SubtiBank
yabR [2019-04-04 13:32:46]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yabR [2019-04-04 13:32:46]

similar to the C-terminal domain of E. coli polyribonucleotide phosphorylase and to four repeated domains at the N-terminus of E. coli ribosomal protein S1
locus
BSU00630
pI
10.34
mw
14.05 kDa
protein length
128 aa Sequence Blast
gene length
387 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    69,626 70,012

    The protein

    Protein family

  • S1 motif domain (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|B0908BB4B8B569A7A78BB0B84784FD4C427C598B|YugI]: 51% identity
  • [SW|Domains]

  • [SW|S1 domain] (aa 4 ... 74) (according to the Interpro database)
  • Structure

  • [PDB|2K4K] ([protein|B0908BB4B8B569A7A78BB0B84784FD4C427C598B|YugI], 51% identity from aa 3 ... 91) [pubmed|19152054]
  • Expression and Regulation

    Operons

    genes
    [gene|D6B1837075ECBEE1FEAC704DDB6795336092897F|yabM]-[gene|52D48F22CB53421EE30970D34B4861E2F8A5893D|yabN]-[gene|B0CB19A3E3E84E12BF42BB050394C8A059A89359|yabO]-[gene|035B5486A3887FC71ACC0A8FB43ED77DC44E12EA|yabP]-[gene|4DEDB27C0162409571AB4A1BB17CFE400764AE45|yabQ]-[gene|FE0E60B875E72AEF5174A89C7AE5556FF59B19D5|divIC]-[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]
    description
    [Pubmed|11283287]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,11283287], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|12207695], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • expressed during sporulation ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|11283287]
  • view in new tab

    genes
    [gene|035B5486A3887FC71ACC0A8FB43ED77DC44E12EA|yabP]-[gene|4DEDB27C0162409571AB4A1BB17CFE400764AE45|yabQ]-[gene|FE0E60B875E72AEF5174A89C7AE5556FF59B19D5|divIC]-[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]
    description
    [Pubmed|11283287]

    regulation

  • expressed during sporulation ([protein|search|SigE]) [Pubmed|11283287]
  • additional information

  • there are about 50,000 molecules of DivIC per cell [http://www.ncbi.nlm.nih.gov/sites/entrez/9426141 PubMed]
  • view in new tab

    genes
    [gene|FE0E60B875E72AEF5174A89C7AE5556FF59B19D5|divIC]-[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]
    description
    [Pubmed|11283287]

    regulation

  • expressed during sporulation ([protein|search|SigE]) [Pubmed|11283287] and under stress conditions
  • additional information

  • there are about 50,000 molecules of DivIC per cell [http://www.ncbi.nlm.nih.gov/sites/entrez/9426141 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B919 (yabR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1918 NBRP B. subtilis, Japan]
  • BKE00630 ([gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAAGTGCTCCTCC, downstream forward: _UP4_TAACTTGCTGCTTTCTATAA
  • BKK00630 ([gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAAGTGCTCCTCC, downstream forward: _UP4_TAACTTGCTGCTTTCTATAA
  • References

  • 11283287,12207695,19152054