SubtiBank SubtiBank
glcK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

glcK

glucose kinase (D-glucose:ATP)
locus
BSU24850
pI
5.99
mw
33.39 kDa
protein length
321 aa Sequence Blast
gene length
966 bp Sequence Blast
function
phosphorylation of the free glucose moiety resulting from cleavage of di-and oligosaccharides
product
glucose kinase (D-glucose:ATP)
essential
no
ec
2.7.1.2
synonyms
yqgR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.20|Utilization of trehalose]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.22|Utilization of maltose]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.23|Utilization of starch/ maltodextrin]
  • Gene

    Coordinates
    2,570,606 2,571,571

    The protein

    Catalyzed reaction/ biological activity

  • ATP + D-glucose = ADP + D-glucose 6-phosphate (according to Swiss-Prot)
  • Protein family

  • ROK (NagC/XylR) family (with [protein|EB6DE119E6FB18413DB2C2B62B114FB787164F74|GmuE] and [protein|AF4395D134485290F4AA307B48494FED39E52CD7|XylR], according to UniProt)
  • Paralogous protein(s)

  • [protein|AF4395D134485290F4AA307B48494FED39E52CD7|XylR]
  • Structure

  • [PDB|2QM1] (from ''Enterococcus faecalis'', 38% identity, 52% similarity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|89C51789FBB2EE86771ABD8629FD99748ED5D4EF|yqgP]-[gene|C44F6723A2F1A627A0B9042871A07F5365D6121A|yqgO]-[gene|8E10A8B566BC25CBDDEF1503656A4234FD29ACB8|glcK]-[gene|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|yqgS]
    description
    [pubmed|22383849]

    additional information

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]∼P binds to the promoter region, but regulation has not been explored [pubmed|25666134]
  • view in new tab

    Biological materials

    Mutant

  • GP2 (spc), available in [SW|Jörg Stülke]'s lab
  • BKE24850 ([gene|8E10A8B566BC25CBDDEF1503656A4234FD29ACB8|glcK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCATATCTCGTCCATTTTTA, downstream forward: _UP4_TAAAATTGTGTAAATGAAAT
  • BKK24850 ([gene|8E10A8B566BC25CBDDEF1503656A4234FD29ACB8|glcK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCATATCTCGTCCATTTTTA, downstream forward: _UP4_TAAAATTGTGTAAATGAAAT
  • References

  • 9620975,15050034,15018644,16707683,7952186,27324299