SubtiBank SubtiBank
ruvB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ruvB

Holliday junction DNA helicase, part of the [protein|7EBC90946E7167A3B0212193873855CAE0EFF7D4|RuvA]-[protein|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|RuvB] branch migration translocase
locus
BSU_27730
pI
5.15
mw
37.31 kDa
protein length
334 aa Sequence Blast
gene length
1005 bp Sequence Blast
function
[SW|DNA repair/ recombination]
product
Holliday junction DNA helicase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.4|Double strand breaks repair]
  • Gene

    Coordinates
    2,835,150 2,836,154

    Phenotypes of a mutant

  • the inactivations of ''[gene|ED1E2011C7E43A8B7E9FD9A471BC11B9DEA73177|recU]'' and ''[gene|7EBC90946E7167A3B0212193873855CAE0EFF7D4|ruvA]-[gene|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|ruvB]'' are synthetically lethal [Pubmed|24770420]
  • the inactivations of ''[gene|A3D05FE662CCCFE79B3CB38486206413B84E5D80|recD2]'' and ''[gene|7EBC90946E7167A3B0212193873855CAE0EFF7D4|ruvA]-[gene|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|ruvB]'' are synthetically lethal [pubmed|28527403]
  • The protein

    Catalyzed reaction/ biological activity

  • [protein|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|RuvB]-ATP stimulates [protein|ED1E2011C7E43A8B7E9FD9A471BC11B9DEA73177|RecU]-mediated Holliday junction resolution [Pubmed|24770420]
  • ATP + H2O --> ADP + H+ + phosphate (according to UniProt)
  • Protein family

  • ruvB family (single member, according to UniProt)
  • Structure

  • [PDB|1IN4] (from Thermotoga maritima, 57% identity) [pubmed|11478862]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|7EBC90946E7167A3B0212193873855CAE0EFF7D4|ruvA]-[gene|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|ruvB]-[gene|6CDF1836F5B613A6718308A4A27D713193EA197B|yrzS]-[gene|23174B2A19DEDF2F20858A005D0681D36E15E6E3|queA]-[gene|0383C8214ADE2FF70CFDB953A65648B37A9D3216|tgt]-[gene|D15B74263167DAD3FA9B7384B5AA4897EAD498F2|yrbF]
    description
    [pubmed|22383849]

    regulation

  • the mRNA is processed between [gene|0383C8214ADE2FF70CFDB953A65648B37A9D3216|tgt] and [gene|D15B74263167DAD3FA9B7384B5AA4897EAD498F2|yrbF] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    genes
    [gene|7EBC90946E7167A3B0212193873855CAE0EFF7D4|ruvA]-[gene|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|ruvB]
    description
    [Pubmed|16267290]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced upon DNA damage ([protein|search|LexA]) [Pubmed|16267290]
  • view in new tab

    Biological materials

    Mutant

  • GP3530 (Δ([gene|7EBC90946E7167A3B0212193873855CAE0EFF7D4|ruvA]-[gene|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|ruvB])::kan), available in [SW|Jörg Stülke]'s lab
  • 1A896 (no resistance), [Pubmed|16020779], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A896&Search=1A896 BGSC]
  • BKE27730 ([gene|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|ruvB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAGCCGTTCATCCATGAACA, downstream forward: _UP4_CATTTCCAAATGGAGGCTCC
  • BKK27730 ([gene|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|ruvB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAGCCGTTCATCCATGAACA, downstream forward: _UP4_CATTTCCAAATGGAGGCTCC
  • References

    Reviews

  • 22933559,9442895
  • Original publications

  • 16267290,24770420,16020779,11478862,28527403