SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


flagellar basal-body protein, membrane anchor of the basal body, flagellar motor switch protein, physically transduces force from [protein|86C729C7D5ABEE519ADC4A893940600BBB655EF1|MotA] to the rotation of [protein|EB815705133E3318F655F6024B7D9BA587FD1DDA|FliF]
38.04 kDa
protein length
338 aa Sequence Blast
gene length
1017 bp Sequence Blast
movement and chemotaxis
flagellar C ring protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,694,119 1,695,135

    Phenotypes of a mutant

  • mucoid phenotype due to the overproduction of poly-gamma-glutamate [Pubmed|24296669]
  • no secretion of [protein|F03144BF8A187C8931938A21433431B8961E8EE7|FlgM], permanent inhibition of [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD] [Pubmed|25313396]
  • The protein

    Catalyzed reaction/ biological activity

  • physically transduces force from [protein|86C729C7D5ABEE519ADC4A893940600BBB655EF1|MotA] to the rotation of [protein|EB815705133E3318F655F6024B7D9BA587FD1DDA|FliF]
  • Protein family

  • FliG family (single member, according to UniProt)
  • Effectors of protein activity

  • interaction with [protein|5D717F9F54693FD0AA8BC49E10348637858F88B9|EpsE] prevents energetization of the flagellum by [protein|86C729C7D5ABEE519ADC4A893940600BBB655EF1|MotA]-[protein|FE56753D061344B0F10A6523F49C5C7356AA40B6|MotB] [Pubmed|18566286]
  • Structure

  • [PDB|3HJL] (from ''Aquifex aeolicus'', 31% identity) [Pubmed|20676082]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9657996], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • BKE16220 ([gene|8DDCC3D139ACCB635BF014946E1282A72D535390|fliG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACGTCTCGCCATTTCTAATT, downstream forward: _UP4_TAATATCATTAAACAAGAAT
  • BKK16220 ([gene|8DDCC3D139ACCB635BF014946E1282A72D535390|fliG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACGTCTCGCCATTTCTAATT, downstream forward: _UP4_TAATATCATTAAACAAGAAT
  • References


  • 30718302
  • Original Publications

  • 1905667,9657996,8157612,15175317,14651647,18566286,17850253,24296669,25313396,24386445,25733861,26244495,20676082,29196522,30455280