SubtiBank SubtiBank
tkmA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

tkmA

transmembrane modulator of [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA] activity, activates [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA] autophosphorylation and substrate phosphorylation
locus
BSU_36260
pI
4.61
mw
26.49 kDa
protein length
248 aa Sequence Blast
gene length
747 bp Sequence Blast
function
control of protein tyrosine phosphorylation
product
modulator of [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA] activity
essential
no
synonyms
ywqC

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.4|Regulation]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,732,525 3,733,271

    Phenotypes of a mutant

  • the mutant exhibits a defect in [SW|biofilm formation], pronounced on LBGM medium, weak of MSgg medium [Pubmed|26283769,20815827], this can be compensated for by overexpression of ''[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]'' or by mutations that reduce the expression of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] [Pubmed|26283769]
  • The protein

    Catalyzed reaction/ biological activity

  • transmembrane activation of [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA] protein tyrosine kinase activity
  • Protein family

  • CapA family (with [protein|A696434A086A428D411CAF45B37CD8F82AC2503F|CapA] and [protein|F6C4634BF871D9A01E27014FFED7527C54BF560D|EpsA], according to UniProt)
  • CpsC/CapA family (with [protein|F6C4634BF871D9A01E27014FFED7527C54BF560D|EpsA], according to UniProt)
  • Paralogous protein(s)

  • [protein|F6C4634BF871D9A01E27014FFED7527C54BF560D|EpsA]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]-[gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]-[gene|CF73D86DB024575BE8F043A4C3996458F4262E46|ptpZ]-[gene|45AFD434F5262BFBE4ED6DF3D18DAED61FF317D1|ugd]
    description
    [Pubmed|20815827,12970183]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20815827], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|26283769], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|26283769], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A034 (ywqC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/34 NBRP B. subtilis, Japan]
  • GP1566 (spc) [Pubmed|24493247], available in [SW|Jörg Stülke]'s lab
  • GP1567 ''[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]''::aphA3 ''[gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]''::spc [Pubmed|24493247], available in [SW|Jörg Stülke]'s lab
  • BKE36260 ([gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATACCTCCAAATCTCT, downstream forward: _UP4_TCTGAAAAAACGGGGAGTGG
  • BKK36260 ([gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATACCTCCAAATCTCT, downstream forward: _UP4_TCTGAAAAAACGGGGAGTGG
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1620 ''tkmA''-FLAG 3x spc (based on [SW|pGP1331]) available in [SW|Jörg Stülke]'s lab
  • References

  • 12970183,20815827,20817675,23939619,24493247,26283769,27725816