cell wall hydrolase, required for conjugation of ICEBs1, part of the type IV secretion system for DNA transfer , C-terminal domain hydrolyzes bond between D-Glu and m-DAP
function
conjugative transfer of ICEBs1
product
cell wall hydrolase
Genomic Context
categories
[category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis][category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.1|ICEBs1]Gene
Coordinates
544,022 → 545,011
The protein
Catalyzed reaction/ biological activity
hydrolysis of peptidoglycan (linkage between N-acetylmuramic acid and N-acetylglucosamine and bond between D-γ-glutamate and meso-diaminopimelic acid) [Pubmed|18305117]Protein family
nlpC/p60 family (according to Swiss-Prot)[SW|Domains]
N-terminal domain is an N-acetylmuramidase that cleaves the linkage between N-acetylmuramic acid and N-acetylglucosamine [Pubmed|18305117]C-terminal endopeptidase domain cleaves the bond between D-γ-glutamate and meso-diaminopimelic acid [Pubmed|18305117][SW|Localization]
secreted (with signal peptide) [Pubmed|24532767]may be a lipoprotein, but the lipid anchor is not required for function [Pubmed|24532767]Biological materials
Mutant
BKE04970 (Δ[gene|8D9D81E05BAA8697F002BB1B8DBC5ABBA557353F|cwlT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATCATCTTGTTCTTTCATC, downstream forward: _UP4_ATTAAATAACTAGGAGTGAABKK04970 (Δ[gene|8D9D81E05BAA8697F002BB1B8DBC5ABBA557353F|cwlT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATCATCTTGTTCTTTCATC, downstream forward: _UP4_ATTAAATAACTAGGAGTGAAReferences
