SubtiBank SubtiBank
cwlT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cwlT

cell wall hydrolase, required for conjugation of ICEBs1, part of the type IV secretion system for DNA transfer , C-terminal domain hydrolyzes bond between D-Glu and m-DAP
locus
BSU_04970
pI
8.63
mw
36.39 kDa
protein length
329 aa Sequence Blast
gene length
990 bp Sequence Blast
function
conjugative transfer of ICEBs1
product
cell wall hydrolase
synonyms
yddH

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.1|ICEBs1]
  • Gene

    Coordinates
    544,022 545,011

    The protein

    Catalyzed reaction/ biological activity

  • hydrolysis of peptidoglycan (linkage between N-acetylmuramic acid and N-acetylglucosamine and bond between D--glutamate and meso-diaminopimelic acid) [Pubmed|18305117]
  • degradation of gamma-polyglutamic acid [pubmed|29458655]
  • Protein family

  • [SW|Peptidase C40 family] (according to UniProt)
  • [SW|Domains]

  • N-terminal domain is an N-acetylmuramidase that cleaves the linkage between N-acetylmuramic acid and N-acetylglucosamine [Pubmed|18305117]
  • C-terminal D,L-endopeptidase domain ([SW|NlpC/P60 domain]) [pubmed|29458655,22139507], cleaves the bond between D--glutamate and meso-diaminopimelic acid [Pubmed|18305117]
  • Effectors of protein activity

  • both enzymatic activities are inhibited by interaction with [protein|0CA55371306D4BD768CFA82027DCB4D581BCCB87|IseA] [pubmed|29458655]
  • Structure

  • [PDB|4FDY] (from Staphylococcus aureus, 42% identity) [pubmed|24051416]
  • [SW|Localization]

  • secreted (with signal peptide) [Pubmed|24532767]
  • may be a lipoprotein, but the lipid anchor is not required for function [Pubmed|24532767]
  • Expression and Regulation

    Operons

    genes
    [gene|EE2A4068CBD7A2F852E582E2EDA4148381F1CD61|xis]-[gene|2227923C603B290AB276238F789D71584FB07DF3|ydzL]-[gene|34451538F10B4ABCFC8A236C8C905A20D989EBCF|ydcO]-[gene|C042792D9A643DCFF4A851EFECA3CF2C31E1EDAF|ydcP]-[gene|4BCAA5939CB7F0DF23495BC92C9EF0A0149296A0|ydcQ]-[gene|8E179976C35FE09F92A191D00E497ED4BF28F571|nicK]-[gene|886B2132717BA4C72433ABE351C5791C9DE1432A|S172]-[gene|1699CFBF5400CAF43C6DAE8ADCCE5A360B31F2E9|ydcS]-[gene|9D4918852A1856B1CDD72D49AEA75E51A8602BB6|ydcT]-[gene|62CEABA069CA2970F22B7E0C369D540A2A027A8D|yddA]-[gene|A0AFD543582D2FE8B1139CF69B7B1F7FF0F80265|conB]-[gene|F273A8817E66B44D58FC2BCB6576A30D8616B750|conC]-[gene|F1F898D7A9FDF78D2E5E8F3BF605E0F735D0542A|conD]-[gene|D20F724D8C3E8C758A9FADF133CD43F066BD8D48|conE]-[gene|B3A07E2A61151C33B7C65D1BC58B97BFDB76852D|yddF]-[gene|3356A43B83E2D4D66098F17A751F0912C1553398|conG]-[gene|8D9D81E05BAA8697F002BB1B8DBC5ABBA557353F|cwlT]-[gene|2E4FF80C857B3F40BA835814EC40D6562721AEFE|yddI]-[gene|2FB1C9435AE924F8E450AFA81F800196A871F2D0|yddJ]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR]: repression, [Pubmed|17511812], in [regulon|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE04970 ([gene|8D9D81E05BAA8697F002BB1B8DBC5ABBA557353F|cwlT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATCATCTTGTTCTTTCATC, downstream forward: _UP4_ATTAAATAACTAGGAGTGAA
  • BKK04970 ([gene|8D9D81E05BAA8697F002BB1B8DBC5ABBA557353F|cwlT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATCATCTTGTTCTTTCATC, downstream forward: _UP4_ATTAAATAACTAGGAGTGAA
  • References

  • 18305117,24532767,24051416,29458655