SubtiBank SubtiBank
artP [2019-06-05 10:46:16]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

artP [2019-06-05 10:46:16]

high affinity arginine [SW|ABC transporter] (ATP-binding protein)
28.16 kDa
protein length
255 aa Sequence Blast
gene length
768 bp Sequence Blast
arginine uptake
high affinity arginine [SW|ABC transporter] (ATP-binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of arginine]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,492,029 2,492,796

    The protein

    Protein family

  • bacterial solute-binding protein 3 family (according to Swiss-Prot)
  • Structure

  • [PDB|4YMX] (from Caldanaerobacter subterraneus, 43% identity) [pubmed|25848002]
  • [SW|Localization]

  • attached to the membrane via [protein|62BD291B91DB0358754957D84A1F3636C247A697|ArtQ] [Pubmed|10092453]
  • extracellular (signal peptide) [Pubmed|18957862], membrane [Pubmed|18763711]
  • Expression and Regulation



    regulatory mechanism

  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials


  • GP1689 Δ([gene|8D9529D46E11D8B2826A98642706ADCBE1E3434A|artP]-[gene|62BD291B91DB0358754957D84A1F3636C247A697|artQ]-[gene|6882EF93EC82872B25C88104F62D6603D2514890|artR])::''mls'', available in [SW|Jörg Stülke]'s lab
  • MGNA-C381 (yqiX::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE23980 ([gene|8D9529D46E11D8B2826A98642706ADCBE1E3434A|artP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCCATTTCCCCCGTA, downstream forward: _UP4_TAAAAAAAAGCGGCTCAACT
  • BKK23980 ([gene|8D9529D46E11D8B2826A98642706ADCBE1E3434A|artP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCCATTTCCCCCGTA, downstream forward: _UP4_TAAAAAAAAGCGGCTCAACT
  • References

  • 10092453,18957862,12107147,18763711,11423008,23038252,25848002