SubtiBank SubtiBank


two-component sensor kinase
41.83 kDa
protein length
379 aa Sequence Blast
gene length
1140 bp Sequence Blast
two-component sensor kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    1,008,668 1,009,807

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|DD799ED3EB79457C27ED30C7B4DBBC2C8F962191|YhcZ] in a Asp residue
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • [SW|Domains]

  • [SW|Histidine kinase domain] (aa 185-373) (according to UniProt)
  • Modification

  • autophosphorylation on a His residue
  • [SW|Localization]

  • cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16816187], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]: activation, [Pubmed|16816187], in [regulon|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR regulon]
  • view in new tab

    Biological materials


  • MGNA-A729 (yhcY::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE09320 ([gene|8D570AEE5D78A9A3CDBB1F457630BAF5DB59BCFD|yhcY]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTTCTCACTCCGGCAT, downstream forward: _UP4_AAAAGCCGAAAAGGAGGGGC
  • BKK09320 ([gene|8D570AEE5D78A9A3CDBB1F457630BAF5DB59BCFD|yhcY]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTTCTCACTCCGGCAT, downstream forward: _UP4_AAAAGCCGAAAAGGAGGGGC
  • References

  • 10094672,20639339,16816187,16479537,29785949