SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


dihydroxy-acid dehydratase (2,3-dihydroxy-3-methylbutanoate, 2,3-dihydroxy-3-methylpentanoate)
59.38 kDa
protein length
558 aa Sequence Blast
gene length
1677 bp Sequence Blast
biosynthesis of branched-chain amino acids
dihydroxy-acid dehydratase (2,3-dihydroxy-3-methylbutanoate, 2,3-dihydroxy-3-methylpentanoate)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of branched-chain amino acids]
  • Gene

    2,300,762 2,302,438

    The protein

    Catalyzed reaction/ biological activity

  • 2,3-dihydroxy-3-methylbutanoate --> 3-methyl-2-oxobutanoate + H2O(according to UniProt)
  • Protein family

  • IlvD/Edd family (single member, according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|2GP4] (apo form of 6-phosphogluconate dehydratase from ''Shewanella oneidensis'', 33% identity)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • view in new tab

    Biological materials


  • BKE21870 ([gene|8D08E5F1EC57A9B3EFFCD7D12D8F16B3B28AEFF0|ilvD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTGATCCTCCTAAATT, downstream forward: _UP4_TAGATAGCTGGGGACACTTT
  • BKK21870 ([gene|8D08E5F1EC57A9B3EFFCD7D12D8F16B3B28AEFF0|ilvD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTGATCCTCCTAAATT, downstream forward: _UP4_TAGATAGCTGGGGACACTTT
  • lacZ fusion

  • pGP522 (in [SW|pAC5]), pGP235 (in [SW|pAC5]), both available in [SW|Jörg Stülke]'s lab
  • a series of promoter deletions in [SW|pAC6] is available in [SW|Jörg Stülke]'s lab
  • References

  • 18083814,12618455,15060025,12107147,24163341,15378759,26220295