SubtiBank SubtiBank
pgpH [2018-03-29 17:55:59]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

pgpH [2018-03-29 17:55:59]

c-di-AMP specific phosphodiesterase
78.98 kDa
protein length
711 aa Sequence Blast
gene length
2133 bp Sequence Blast
control of c-di-AMP homeostasis
c-di-AMP specific phosphodiesterase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.3|Targets of (p)ppGpp]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,612,282 → 2,614,417

    Phenotypes of a mutant

  • a ''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP] [gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]'' double mutant acquires suppressor mutations in ''[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]'' [Pubmed|26240071]
  • a ''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP] [gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]'' double mutant is defective in [SW|biofilm formation] [Pubmed|27252699]
  • The protein

    Catalyzed reaction/ biological activity

  • hydrolysis of c-di-AMP to 5'-pApA [Pubmed|25583510]
  • [SW|Domains]

  • [SW|HD domain]
  • [SW|Cofactors]

  • Mn2+ [Pubmed|25583510]
  • Effectors of protein activity

  • ppGpp acts as allosteric inhibitor of phosphodiesterase activity (in ''Listeria monocytogenes'') [Pubmed|25583510]
  • Structure

  • [PDB|4S1B] (the HD domain of the protein from ''Listeria monocytogenes'' in complex with c-di-AMP, 58% identity, 85% similarity) [Pubmed|25583510]
  • [SW|Localization]

  • cell membrane [Pubmed|25583510]
  • Biological materials


  • MGNA-C432 (yqfF::erm), available at the [ NBRP B. subtilis, Japan]
  • SM-GN1 (''pgpH-spc''), available in [SW|Anne Galinier]'s and [SW|Boris Görke]'s labs
  • BKE25330 (''[gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]''::''erm'' without terminator, available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • GP2033 (''[gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]''::''tet'', available in [SW|Jörg Stülke]'s lab)
  • GP2034 (''[gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]''::''erm'' without terminator, available in [SW|Jörg Stülke]'s lab) [Pubmed|26240071]
  • GP2040 (''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]''::''spc'' ''[gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]''::''erm'' without terminator, available in [SW|Jörg Stülke]'s lab) [Pubmed|26240071]
  • GP2049 (''[gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]''::''cat'' without terminator, available in [SW|Jörg Stülke]'s lab)
  • BKE25330 (Δ[gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAGAACCTCCTCTTGAA, downstream forward: _UP4_GAGGCTACTAAGAAGGTGAA
  • BKK25330 (Δ[gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAGAACCTCCTCTTGAA, downstream forward: _UP4_GAGGCTACTAAGAAGGTGAA
  • lacZ fusion

  • pGP190 (in [protein|search|pAC7]), available in [SW|Stülke] lab
  • References


  • 25637595,25869574,26773214
  • Original publications

  • 21630458,25583510,26240071,27252699