SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


19.06 kDa
protein length
166 aa Sequence Blast
gene length
501 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    2,244,230 2,244,730

    Biological materials


  • BKE21280 ([gene|8CDCA76E51D25037DE5A5AC0D6FBD14BA7C5641A|yomO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAATATCCTCCTTAAT, downstream forward: _UP4_ATAGAGACTGGTTCTGGTGA
  • BKK21280 ([gene|8CDCA76E51D25037DE5A5AC0D6FBD14BA7C5641A|yomO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAATATCCTCCTTAAT, downstream forward: _UP4_ATAGAGACTGGTTCTGGTGA