SubtiBank SubtiBank
sboA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sboA

subtilosin A
locus
BSU_37350
pI
4.57
mw
4.19 kDa
protein length
gene length
132 bp Sequence Blast
function
antimicrobial peptide
product
subtilosin A
essential
no
synonyms
sbo

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    3,836,058 3,836,189

    The protein

    Protein family

  • bacteriocin class V family (single member, according to UniProt)
  • Structure

  • [PDB|1PXQ]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|8CBBEC47A5CC3EAE73BE68E68417C5F2A4DA5C23|sboA]-[gene|83AAFAA187B4FCEE24B4EA2DD4935425A3B48DAA|sboX]-[gene|DEDA6F03386F360F6C0B2CC5F09DF3C9D85173F1|albA]-[gene|D399B25AE22ECB6C7ACDCFF4DCE4D9D908184E75|albB]-[gene|19CC58F5ABADAD45BA55D88BBD77B586AA5D85FE|albC]-[gene|DAD8308DF72E648610D1A12BC92063E1550CB1B4|albD]-[gene|A474F01AA4AD859963E39CD528BC42FF43A72433|albE]-[gene|D03FB4EAEFBC25A5B0459CF464BFADF1FC7620B2|albF]-[gene|55A34610EF7AA5E515DE3DCDA333ED3A42B0EF08|albG]
    description
    [Pubmed|10572140]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10572140], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10809710], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|10572140,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [Pubmed|10809710]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • BKE37350 ([gene|8CBBEC47A5CC3EAE73BE68E68417C5F2A4DA5C23|sboA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTGAATCCTCCCTTT, downstream forward: _UP4_CTAGTGGACGGTCCTATCCC
  • BKK37350 ([gene|8CBBEC47A5CC3EAE73BE68E68417C5F2A4DA5C23|sboA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTGAATCCTCCCTTT, downstream forward: _UP4_CTAGTGGACGGTCCTATCCC
  • References

  • 10809709,10572140,15743949,10809710,10572140,17720793,31113899