SubtiBank SubtiBank
yqaD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqaD

unknown
locus
BSU_26360
pI
10.34
mw
6.63 kDa
protein length
gene length
168 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,699,510 2,699,677

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • BKE26360 ([gene|8CA66DC93017E9C38E660A961F8AC2CB62B6E70A|yqaD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTAAACTCCTTTGAA, downstream forward: _UP4_TAACAAGAAGCCCTCTTTTC
  • BKK26360 ([gene|8CA66DC93017E9C38E660A961F8AC2CB62B6E70A|yqaD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTAAACTCCTTTGAA, downstream forward: _UP4_TAACAAGAAGCCCTCTTTTC