SubtiBank SubtiBank
yqaD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqaD

unknown
locus
BSU_26360
pI
10.34
mw
6.63 kDa
protein length
gene length
168 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,699,510 2,699,677

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • BKE26360 ([gene|8CA66DC93017E9C38E660A961F8AC2CB62B6E70A|yqaD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTAAACTCCTTTGAA, downstream forward: _UP4_TAACAAGAAGCCCTCTTTTC
  • BKK26360 ([gene|8CA66DC93017E9C38E660A961F8AC2CB62B6E70A|yqaD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTAAACTCCTTTGAA, downstream forward: _UP4_TAACAAGAAGCCCTCTTTTC