SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


cell-division inhibitor (septum placement), destabilizes Z ring placement
24.85 kDa
protein length
226 aa Sequence Blast
gene length
681 bp Sequence Blast
septum placement
cell-division inhibitor

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW|The Min system]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,858,584 2,859,264

    Phenotypes of a mutant

  • a ''[gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA] [gene|8C94C9598A823A8405B3E1FA0124E21D90845B8E|minC]-[gene|37DAD42A391E2FC506225EAF91B8F21629A401DF|minD]'' mutant grows poorly, and the cells are filamentous [Pubmed|24097947]
  • The protein

    Catalyzed reaction/ biological activity

  • The Min system prevents minicell formation adjacent to recently completed division sites by promoting the disassembly of the cytokinetic ring, thereby ensuring that cell division occurs only once per cell cycle [Pubmed|20352045]
  • binds the C-terminal domain of [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ] to inhibit its polymerization [Pubmed|23577149]
  • Protein family

  • minC family (single member, according to UniProt)
  • Structure

  • [PDB|1HF2] (from ''Thermotoga maritima'', 26% identity) [Pubmed|11350934]
  • [SW|Localization]

  • polar/ septal at the cell membrane [Pubmed|20566861]
  • membrane binding/ polar localization depends on the proton motive force [Pubmed|20566861]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, promoter p1, upstream of [protein|49D996C9AED44A820A214C3DF60AB1B6E1508DEA|Maf] [Pubmed|26091431], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, promoter p2, within [protein|49D996C9AED44A820A214C3DF60AB1B6E1508DEA|Maf] [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, promoter p4, upstream of [protein|8C94C9598A823A8405B3E1FA0124E21D90845B8E|MinC] [Pubmed|8459776], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|26091431], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • constitutively expressed [Pubmed|23701187]
  • view in new tab



  • constitutively expressed [Pubmed|23701187]
  • view in new tab


    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, promoter p2 within [protein|49D996C9AED44A820A214C3DF60AB1B6E1508DEA|Maf] [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, promoter p1, upstream of [protein|49D996C9AED44A820A214C3DF60AB1B6E1508DEA|Maf] [Pubmed|26091431], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|11948146,11918817,21564336], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • constitutively expressed [Pubmed|23701187]
  • view in new tab

    Biological materials


  • BSN375 (''[gene|8C94C9598A823A8405B3E1FA0124E21D90845B8E|minC]''::''aphA3'') (available in [SW|Leendert Hamoen]'s, [SW|Sven Halbedel]'s and [SW|Jörg Stülke]'s labs)
  • BKE28000 ([gene|8C94C9598A823A8405B3E1FA0124E21D90845B8E|minC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATATTCACCTCAACAA, downstream forward: _UP4_ACAAGGCTTGAGGGAGGAAT
  • BKK28000 ([gene|8C94C9598A823A8405B3E1FA0124E21D90845B8E|minC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATATTCACCTCAACAA, downstream forward: _UP4_ACAAGGCTTGAGGGAGGAAT
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References


  • 19680248,19884039,24367361,28697666
  • Original Publications

  • 8459776,19019154,1400224,10411726,15317782,20352045,18588879,19141479,20566861,20711458,24097947,18179421,22457634,23577149,21926231,23701187,24366721,11350934,22383849,26091431,30092000