SubtiBank SubtiBank
clpE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

clpE

AAA unfoldase, ATPase subunit of the [protein|8C5B14FE5E03427F9A598C75D4081FA0D6696299|ClpE]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] protease (class III stress gene)
locus
BSU13700
pI
5.14
mw
77.72 kDa
protein length
699 aa Sequence Blast
gene length
2100 bp Sequence Blast
function
protein degradation
product
AAA unfoldase, ATPase subunit of the [protein|8C5B14FE5E03427F9A598C75D4081FA0D6696299|ClpE]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] protease
essential
no
synonyms
ykvH

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    Coordinates
    1,435,628 1,437,727

    The protein

    Catalyzed reaction/ biological activity

  • ATPase/chaperone
  • Protein family

  • ClpA/ClpB family (with [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC], according to UniProt)
  • Paralogous protein(s)

  • [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]
  • [SW|Domains]

  • AAA-ATPase [http://pfam.sanger.ac.uk/family?acc=PF07724 PFAM]
  • Structure

  • [PDB|6EM8] ([protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] from Staphylococcus aureus, 54% identity) [pubmed|29165246]
  • [SW|Localization]

  • localization in cytoplasmic polar clusters, excluded from the nucleoid, colocalization with [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] [http://www.ncbi.nlm.nih.gov/pubmed/18786145 Pubmed]
  • forms foci coincident with nucleoid edges, usually near cell poles [Pubmed|18689473]
  • Expression and Regulation

    Operons

    genes
    [gene|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE]
    description
    [Pubmed|10320580]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10320580], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [Pubmed|10320580,9987115,11179229,16163393,17380125], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • regulation

  • induced by heat ([protein|search|CtsR]) [Pubmed|10320580,9987115]
  • view in new tab

    Biological materials

    Mutant

  • ''clpE::spec'' available from the [http://subtiwiki.uni-goettingen.de/wiki/index.php/Leendert_Hamoen Hamoen]] Lab
  • BKE13700 ([gene|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCCAAAACCTCCTTA, downstream forward: _UP4_TAACAATCAGCGGTTTCCTT
  • BKK13700 ([gene|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCCAAAACCTCCTTA, downstream forward: _UP4_TAACAATCAGCGGTTTCCTT
  • GFP fusion

  • C-terminal YFP and CFP fusions (single copy) available from the [http://subtiwiki.uni-goettingen.de/wiki/index.php/Leendert_Hamoen Hamoen]] Lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1799 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Ulf Gerth]'s and [SW|Jörg Stülke]'s labs
  • References

    Reviews

  • 26639779,28748186
  • Original Publications

  • 17302811,29165246
  • Labs working on this gene/protein

  • [SW|Leendert Hamoen], Newcastle University, UK [http://www.ncl.ac.uk/camb/staff/profile/l.hamoen homepage]