SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


AAA unfoldase, ATPase subunit of the [protein|8C5B14FE5E03427F9A598C75D4081FA0D6696299|ClpE]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] protease (class III stress gene)
77.72 kDa
protein length
699 aa Sequence Blast
gene length
2100 bp Sequence Blast
protein degradation
AAA unfoldase, ATPase subunit of the [protein|8C5B14FE5E03427F9A598C75D4081FA0D6696299|ClpE]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] protease

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    1,435,628 1,437,727

    The protein

    Catalyzed reaction/ biological activity

  • ATPase/chaperone
  • Protein family

  • ClpA/ClpB family (with [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC], according to UniProt)
  • Paralogous protein(s)

  • [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]
  • [SW|Domains]

  • AAA-ATPase [ PFAM]
  • [SW|UVR domain] (aa 325-360) (according to UniProt)
  • Structure

  • [PDB|6EM8] ([protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] from Staphylococcus aureus, 54% identity) [pubmed|29165246]
  • [SW|Localization]

  • localization in cytoplasmic polar clusters, excluded from the nucleoid, colocalization with [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] [ Pubmed]
  • forms foci coincident with nucleoid edges, usually near cell poles [Pubmed|18689473]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10320580], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [Pubmed|10320580,9987115,11179229,16163393,17380125], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • regulation

  • induced by heat ([protein|search|CtsR]) [Pubmed|10320580,9987115]
  • view in new tab

    Biological materials


  • ''clpE::spec'' available from the [ Hamoen]] Lab
  • BKE13700 ([gene|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCCAAAACCTCCTTA, downstream forward: _UP4_TAACAATCAGCGGTTTCCTT
  • BKK13700 ([gene|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCCAAAACCTCCTTA, downstream forward: _UP4_TAACAATCAGCGGTTTCCTT
  • GFP fusion

  • C-terminal YFP and CFP fusions (single copy) available from the [ Hamoen]] Lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1799 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Ulf Gerth]'s and [SW|Jörg Stülke]'s labs
  • References


  • 26639779,28748186
  • Original Publications

  • 17302811,29165246
  • Labs working on this gene/protein

  • [SW|Leendert Hamoen], Newcastle University, UK [ homepage]