clpE

AAA unfoldase, ATPase subunit of the [protein|8C5B14FE5E03427F9A598C75D4081FA0D6696299|ClpE]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] protease (class III stress gene)

locus: BSU_13700

pI: 5.14

mw: 77.72 kDa

protein length: 699 aa

gene length: 2100 bp

function: protein degradation

product: AAA unfoldase, ATPase subunit of the [protein|8C5B14FE5E03427F9A598C75D4081FA0D6696299|ClpE]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] protease

essential: no

synonyms: ykvH

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]

Gene

Coordinates: 1,435,628 1,437,727

The protein

Catalyzed reaction/ biological activity

• ATPase/chaperone

Protein family

• ClpA/ClpB family (with [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC], according to UniProt)

Paralogous protein(s)

• [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]

[SW|Domains]

• AAA-ATPase [http://pfam.sanger.ac.uk/family?acc=PF07724 PFAM]
• [SW|UVR domain] (aa 325-360) (according to UniProt)

Structure

• [PDB|6EM8] ([protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] from Staphylococcus aureus, 54% identity) [pubmed|29165246]

[SW|Localization]

• localization in cytoplasmic polar clusters, excluded from the nucleoid, colocalization with [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] [http://www.ncbi.nlm.nih.gov/pubmed/18786145 Pubmed]
• forms foci coincident with nucleoid edges, usually near cell poles [Pubmed|18689473]

Expression and Regulation

Operons

• genes: [gene|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE]
  description: [Pubmed|10320580]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10320580], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]

  regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [Pubmed|10320580,9987115,11179229,16163393,17380125], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]

  regulation

  • induced by heat ([protein|search|CtsR]) [Pubmed|10320580,9987115]

Biological materials

Mutant

• ''clpE::spec'' available from the [http://subtiwiki.uni-goettingen.de/wiki/index.php/Leendert_Hamoen Hamoen]] Lab
• BKE13700 ([gene|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCCAAAACCTCCTTA, downstream forward: _UP4_TAACAATCAGCGGTTTCCTT
• BKK13700 ([gene|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCCAAAACCTCCTTA, downstream forward: _UP4_TAACAATCAGCGGTTTCCTT

GFP fusion

• C-terminal YFP and CFP fusions (single copy) available from the [http://subtiwiki.uni-goettingen.de/wiki/index.php/Leendert_Hamoen Hamoen]] Lab

two-hybrid system

• ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab

FLAG-tag construct

• GP1799 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab

Antibody

• available in [SW|Ulf Gerth]'s and [SW|Jörg Stülke]'s labs

References

Reviews

• 26639779,28748186

Original Publications

• 17302811,29165246

Labs working on this gene/protein

• [SW|Leendert Hamoen], Newcastle University, UK [http://www.ncl.ac.uk/camb/staff/profile/l.hamoen homepage]