SubtiBank SubtiBank
pucH
The papers of the month are back! Check them out! Link here

pucH

allantoinase
locus
BSU32410
pI
5.06
mw
48.17 kDa
protein length
446 aa Sequence Blast
gene length
1338 bp Sequence Blast
function
purine utilization
product
allantoinase
essential
no
ec
3.5.2.5
synonyms
yunH

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    Coordinates
    3,327,247 → 3,328,587

    The protein

    Catalyzed reaction/ biological activity

  • (S)-allantoin + H2O = allantoate (according to Swiss-Prot)
  • Protein family

  • Allantoinase subfamily (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|PyrC]
  • Structure

  • [PDB|3HM7] (from ''Bacillus halodurans'', 44% identity, 65% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|8C53FEBB2BCCE45A686119B7ECE4C266D2C0822A|pucH]
    description
    [Pubmed|12029039]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029039], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • induced in the presence of purine nucleotides (inducer: allantoin) ([protein|search|PucR]) [Pubmed|12029039]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A933 (yunH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/933 NBRP B. subtilis, Japan]
  • BKE32410 (Δ[gene|8C53FEBB2BCCE45A686119B7ECE4C266D2C0822A|pucH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGATCCCCCCATGTC, downstream forward: _UP4_TAAGCCCGGCGGATTTTACC
  • BKK32410 (Δ[gene|8C53FEBB2BCCE45A686119B7ECE4C266D2C0822A|pucH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGATCCCCCCATGTC, downstream forward: _UP4_TAAGCCCGGCGGATTTTACC
  • References

  • 11344136,12029039