SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


48.17 kDa
protein length
446 aa Sequence Blast
gene length
1341 bp Sequence Blast
purine utilization

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    3,327,247 3,328,587

    The protein

    Catalyzed reaction/ biological activity

  • (S)-allantoin + H2O = allantoate (according to Swiss-Prot)
  • Protein family

  • [SW|Metallo-dependent hydrolases superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|PyrC]
  • Structure

  • [PDB|3HM7] (from ''Bacillus halodurans'', 44% identity, 65% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029039], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • induced in the presence of purine nucleotides (inducer: allantoin) ([protein|search|PucR]) [Pubmed|12029039]
  • view in new tab

    Biological materials


  • MGNA-A933 (yunH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32410 ([gene|8C53FEBB2BCCE45A686119B7ECE4C266D2C0822A|pucH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGATCCCCCCATGTC, downstream forward: _UP4_TAAGCCCGGCGGATTTTACC
  • BKK32410 ([gene|8C53FEBB2BCCE45A686119B7ECE4C266D2C0822A|pucH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGATCCCCCCATGTC, downstream forward: _UP4_TAAGCCCGGCGGATTTTACC
  • References

  • 11344136,12029039