SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


putative leucine permease
49.01 kDa
protein length
447 aa Sequence Blast
gene length
1344 bp Sequence Blast
putative leucine permease

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|Other amino acid transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,489,910 3,491,253

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|YbxG], [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|RocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|RocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|YbgF], [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|YdgF], [protein|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|AapA], [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|GabP], [protein|219586A3F378DC38EA076FD39B99D41136BDE722|YtnA], [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|HutM]
  • Structure

  • [PDB|3GI9] (from ''M. jannaschii'', 23% identity) [Pubmed|19608859]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [regulon|T-box|T-box]: anti-termination, in [regulon|T-box|T-box]
  • regulation:

  • the [SW|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • GP3038 Δ''[gene|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|yvbW]''::''cat'', available in [SW|Jörg Stülke]'s lab
  • MGNA-A468 (yvbW::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34010 ([gene|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|yvbW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTCTTCTACCTCTCCT, downstream forward: _UP4_TAAATAAGAAACCCTCTTGC
  • BKK34010 ([gene|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|yvbW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTCTTCTACCTCTCCT, downstream forward: _UP4_TAAATAAGAAACCCTCTTGC
  • References

  • 18625071,19608859,29794222