SubtiBank SubtiBank
yvbW
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvbW

putative leucine permease
locus
BSU34010
pI
9.84
mw
49.01 kDa
protein length
447 aa Sequence Blast
gene length
1344 bp Sequence Blast
function
unknown
product
putative leucine permease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.2|Other amino acid transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,489,910 3,491,253

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|YbxG], [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|RocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|RocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|YbgF], [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|YdgF], [protein|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|AapA], [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|GabP], [protein|219586A3F378DC38EA076FD39B99D41136BDE722|YtnA], [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|HutM]
  • Structure

  • [PDB|3GI9] (from ''M. jannaschii'', 23% identity) [Pubmed|19608859]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|yvbW]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [regulon|T-box|T-box]: anti-termination, in [regulon|T-box|T-box]
  • regulation:

  • the [SW|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • GP3038 Δ''[gene|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|yvbW]''::''cat'', available in [SW|Jörg Stülke]'s lab
  • MGNA-A468 (yvbW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/468 NBRP B. subtilis, Japan]
  • BKE34010 ([gene|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|yvbW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTCTTCTACCTCTCCT, downstream forward: _UP4_TAAATAAGAAACCCTCTTGC
  • BKK34010 ([gene|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|yvbW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTCTTCTACCTCTCCT, downstream forward: _UP4_TAAATAAGAAACCCTCTTGC
  • References

  • 18625071,19608859,29794222