SubtiBank SubtiBank
yvbW
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvbW

putative leucine permease
locus
BSU_34010
pI
9.84
mw
49.01 kDa
protein length
447 aa Sequence Blast
gene length
1344 bp Sequence Blast
function
unknown
product
putative leucine permease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.4|APC superfamily]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,489,910 3,491,253

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|YbxG], [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|RocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|RocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|YbgF], [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|YdgF], [protein|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|AapA], [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|GabP], [protein|219586A3F378DC38EA076FD39B99D41136BDE722|YtnA], [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|HutM]
  • Structure

  • [PDB|3GI9] (from ''M. jannaschii'', 23% identity) [Pubmed|19608859]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|yvbW]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [regulon|T-box|T-box]: anti-termination, in [regulon|T-box|T-box]
  • regulation:

  • the [SW|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • GP3038 Δ''[gene|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|yvbW]''::''cat'', available in [SW|Jörg Stülke]'s lab
  • MGNA-A468 (yvbW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/468 NBRP B. subtilis, Japan]
  • BKE34010 ([gene|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|yvbW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTCTTCTACCTCTCCT, downstream forward: _UP4_TAAATAAGAAACCCTCTTGC
  • BKK34010 ([gene|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|yvbW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTCTTCTACCTCTCCT, downstream forward: _UP4_TAAATAAGAAACCCTCTTGC
  • References

  • 18625071,19608859,29794222